FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625450_at:

>probe:Drosophila_2:1625450_at:133:241; Interrogation_Position=1530; Antisense; AATAATGGTCGTTAGCTGGCTGCTC
>probe:Drosophila_2:1625450_at:654:237; Interrogation_Position=1560; Antisense; AATAACATTTTACTCGGGATCGAAT
>probe:Drosophila_2:1625450_at:678:243; Interrogation_Position=1588; Antisense; AATTACCTGATACTCTGTGACATGG
>probe:Drosophila_2:1625450_at:115:479; Interrogation_Position=1630; Antisense; GTTTGGGTACTGCTCATTTTTCTAG
>probe:Drosophila_2:1625450_at:413:17; Interrogation_Position=1645; Antisense; ATTTTTCTAGTCGTGCGCAGGCGTC
>probe:Drosophila_2:1625450_at:503:517; Interrogation_Position=1686; Antisense; GTGGTGGTATGATCGTGGTTCCCAC
>probe:Drosophila_2:1625450_at:354:519; Interrogation_Position=1700; Antisense; GTGGTTCCCACGAAATTGAAGGCAC
>probe:Drosophila_2:1625450_at:271:361; Interrogation_Position=1731; Antisense; GCAAGCTCTTAGTAATAGTCCCACA
>probe:Drosophila_2:1625450_at:1:27; Interrogation_Position=1789; Antisense; ATACGTTCAAATCTGCGATCGCCGT
>probe:Drosophila_2:1625450_at:378:623; Interrogation_Position=1802; Antisense; TGCGATCGCCGTTAATATTACATTA
>probe:Drosophila_2:1625450_at:1:115; Interrogation_Position=1932; Antisense; AGCTGAACCTGATATCCTTTAATAG
>probe:Drosophila_2:1625450_at:5:107; Interrogation_Position=1955; Antisense; AGAATATATGTTGTTGCGGGCCACA
>probe:Drosophila_2:1625450_at:676:621; Interrogation_Position=1969; Antisense; TGCGGGCCACATTACCGAACCATTT
>probe:Drosophila_2:1625450_at:208:481; Interrogation_Position=2074; Antisense; GTTTGCTGTCACTTATATGGTCATA

Paste this into a BLAST search page for me
AATAATGGTCGTTAGCTGGCTGCTCAATAACATTTTACTCGGGATCGAATAATTACCTGATACTCTGTGACATGGGTTTGGGTACTGCTCATTTTTCTAGATTTTTCTAGTCGTGCGCAGGCGTCGTGGTGGTATGATCGTGGTTCCCACGTGGTTCCCACGAAATTGAAGGCACGCAAGCTCTTAGTAATAGTCCCACAATACGTTCAAATCTGCGATCGCCGTTGCGATCGCCGTTAATATTACATTAAGCTGAACCTGATATCCTTTAATAGAGAATATATGTTGTTGCGGGCCACATGCGGGCCACATTACCGAACCATTTGTTTGCTGTCACTTATATGGTCATA

Full Affymetrix probeset data:

Annotations for 1625450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720