FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625451_at:

>probe:Drosophila_2:1625451_at:289:187; Interrogation_Position=1032; Antisense; AACACCAAGATCTCAGGCCACTACG
>probe:Drosophila_2:1625451_at:442:671; Interrogation_Position=1053; Antisense; TACGCCGCACCGCTTCAAGAAGGGA
>probe:Drosophila_2:1625451_at:210:105; Interrogation_Position=1077; Antisense; AGACATCGTGGAGTCGGAATCCGGC
>probe:Drosophila_2:1625451_at:682:347; Interrogation_Position=1142; Antisense; GCATGCTCTGCACCAAGGAATCTCA
>probe:Drosophila_2:1625451_at:403:119; Interrogation_Position=1166; Antisense; AGCGGCGCGGCTACTGTTCACGGCA
>probe:Drosophila_2:1625451_at:585:535; Interrogation_Position=1240; Antisense; GGTCGTCTGCTCAGTGACAGTCGAT
>probe:Drosophila_2:1625451_at:244:411; Interrogation_Position=1275; Antisense; GACGCAAATCGATGAGGACACCTCT
>probe:Drosophila_2:1625451_at:529:103; Interrogation_Position=1310; Antisense; AGACGTCGCCGAACTATCGGGTCAA
>probe:Drosophila_2:1625451_at:690:637; Interrogation_Position=1326; Antisense; TCGGGTCAAAGGTCGCTACGATCAG
>probe:Drosophila_2:1625451_at:40:51; Interrogation_Position=1372; Antisense; ATGCTGGGTAAGTCTCTTCGGCACC
>probe:Drosophila_2:1625451_at:473:181; Interrogation_Position=886; Antisense; AAAAGGGTCGGCATCGGATACTCGC
>probe:Drosophila_2:1625451_at:184:57; Interrogation_Position=940; Antisense; ATGAGCGCCTGCAGCAAGCGGAGCA
>probe:Drosophila_2:1625451_at:43:115; Interrogation_Position=961; Antisense; AGCAGCATGCAAAGCCGCGGCAGCA
>probe:Drosophila_2:1625451_at:194:89; Interrogation_Position=991; Antisense; AGTCTTCTCGACCAGAGGCTCACAC

Paste this into a BLAST search page for me
AACACCAAGATCTCAGGCCACTACGTACGCCGCACCGCTTCAAGAAGGGAAGACATCGTGGAGTCGGAATCCGGCGCATGCTCTGCACCAAGGAATCTCAAGCGGCGCGGCTACTGTTCACGGCAGGTCGTCTGCTCAGTGACAGTCGATGACGCAAATCGATGAGGACACCTCTAGACGTCGCCGAACTATCGGGTCAATCGGGTCAAAGGTCGCTACGATCAGATGCTGGGTAAGTCTCTTCGGCACCAAAAGGGTCGGCATCGGATACTCGCATGAGCGCCTGCAGCAAGCGGAGCAAGCAGCATGCAAAGCCGCGGCAGCAAGTCTTCTCGACCAGAGGCTCACAC

Full Affymetrix probeset data:

Annotations for 1625451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720