FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625452_at:

>probe:Drosophila_2:1625452_at:26:95; Interrogation_Position=2335; Antisense; AGTTCCTTGGAGAGCAGCGACCTGA
>probe:Drosophila_2:1625452_at:540:137; Interrogation_Position=2368; Antisense; ACGAGCCCTTCGTGCGGCAAAAAGG
>probe:Drosophila_2:1625452_at:50:185; Interrogation_Position=2387; Antisense; AAAAGGAGCTGATGCTGCTGCCCAC
>probe:Drosophila_2:1625452_at:475:621; Interrogation_Position=2402; Antisense; TGCTGCCCACATCCGTGATAAGGGA
>probe:Drosophila_2:1625452_at:412:81; Interrogation_Position=2422; Antisense; AGGGATGACAGCGTGACCACCTATA
>probe:Drosophila_2:1625452_at:190:643; Interrogation_Position=2466; Antisense; TCTGCCACCGCCTACGAGGAGAAAA
>probe:Drosophila_2:1625452_at:286:103; Interrogation_Position=2498; Antisense; AGACCACCCAAGAGCTGGCGGAGTT
>probe:Drosophila_2:1625452_at:225:383; Interrogation_Position=2588; Antisense; GAACGTTGCCCAGTTTCGGGAATGT
>probe:Drosophila_2:1625452_at:204:563; Interrogation_Position=2630; Antisense; GGAAGCACTTCTTGCGGACACGATC
>probe:Drosophila_2:1625452_at:561:633; Interrogation_Position=2773; Antisense; TCGCCTATGCTTAATCGCAACTCAG
>probe:Drosophila_2:1625452_at:129:641; Interrogation_Position=2812; Antisense; TCGGCACTTCTAGTCCAGAATCTGT
>probe:Drosophila_2:1625452_at:35:505; Interrogation_Position=2824; Antisense; GTCCAGAATCTGTGCAGCTTGGCAG
>probe:Drosophila_2:1625452_at:383:607; Interrogation_Position=2858; Antisense; TGAGGAATTCCGCATCCAACAGTTC
>probe:Drosophila_2:1625452_at:683:615; Interrogation_Position=2885; Antisense; TGCAGAGTCTCAGCTCCAATTCGAG

Paste this into a BLAST search page for me
AGTTCCTTGGAGAGCAGCGACCTGAACGAGCCCTTCGTGCGGCAAAAAGGAAAAGGAGCTGATGCTGCTGCCCACTGCTGCCCACATCCGTGATAAGGGAAGGGATGACAGCGTGACCACCTATATCTGCCACCGCCTACGAGGAGAAAAAGACCACCCAAGAGCTGGCGGAGTTGAACGTTGCCCAGTTTCGGGAATGTGGAAGCACTTCTTGCGGACACGATCTCGCCTATGCTTAATCGCAACTCAGTCGGCACTTCTAGTCCAGAATCTGTGTCCAGAATCTGTGCAGCTTGGCAGTGAGGAATTCCGCATCCAACAGTTCTGCAGAGTCTCAGCTCCAATTCGAG

Full Affymetrix probeset data:

Annotations for 1625452_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720