Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625453_a_at:

>probe:Drosophila_2:1625453_a_at:149:97; Interrogation_Position=1056; Antisense; AGAGACTTTTTAGACCTTCATCGGT
>probe:Drosophila_2:1625453_a_at:538:9; Interrogation_Position=1117; Antisense; ATTCATTATGACTACTGCGGTTCTT
>probe:Drosophila_2:1625453_a_at:71:403; Interrogation_Position=1126; Antisense; GACTACTGCGGTTCTTAAGCTAAGT
>probe:Drosophila_2:1625453_a_at:340:433; Interrogation_Position=1169; Antisense; GAGGGCATTCGATTGTGTTGGCCCC
>probe:Drosophila_2:1625453_a_at:720:221; Interrogation_Position=1282; Antisense; AAGGACTCGGAATACTTACTCGGAG
>probe:Drosophila_2:1625453_a_at:335:707; Interrogation_Position=1297; Antisense; TTACTCGGAGCACTTAAGCCTAAGT
>probe:Drosophila_2:1625453_a_at:561:17; Interrogation_Position=1344; Antisense; ATTTATTGTGCAGCCGTTATGTTAA
>probe:Drosophila_2:1625453_a_at:217:29; Interrogation_Position=1378; Antisense; ATAAAAAAGCGCTGCCCCTGTAATA
>probe:Drosophila_2:1625453_a_at:708:203; Interrogation_Position=828; Antisense; AAGCCCTTACACTTAACAGCAGAAA
>probe:Drosophila_2:1625453_a_at:88:479; Interrogation_Position=864; Antisense; GTTTACCTAACAGCACAGATACTAC
>probe:Drosophila_2:1625453_a_at:72:457; Interrogation_Position=881; Antisense; GATACTACCAACTTTCTACATACAT
>probe:Drosophila_2:1625453_a_at:173:21; Interrogation_Position=912; Antisense; ATATTTTATGGAGCCCGTCTTCGAT
>probe:Drosophila_2:1625453_a_at:650:497; Interrogation_Position=928; Antisense; GTCTTCGATTTCTATGCCCATAGGG
>probe:Drosophila_2:1625453_a_at:589:217; Interrogation_Position=988; Antisense; AAGTGCAATCTTCCTTTTAAATTAT

Paste this into a BLAST search page for me
AGAGACTTTTTAGACCTTCATCGGTATTCATTATGACTACTGCGGTTCTTGACTACTGCGGTTCTTAAGCTAAGTGAGGGCATTCGATTGTGTTGGCCCCAAGGACTCGGAATACTTACTCGGAGTTACTCGGAGCACTTAAGCCTAAGTATTTATTGTGCAGCCGTTATGTTAAATAAAAAAGCGCTGCCCCTGTAATAAAGCCCTTACACTTAACAGCAGAAAGTTTACCTAACAGCACAGATACTACGATACTACCAACTTTCTACATACATATATTTTATGGAGCCCGTCTTCGATGTCTTCGATTTCTATGCCCATAGGGAAGTGCAATCTTCCTTTTAAATTAT

Full Affymetrix probeset data:

Annotations for 1625453_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime