FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625454_at:

>probe:Drosophila_2:1625454_at:578:37; Interrogation_Position=1009; Antisense; ATCTTTGGCGTCAATTCGGTGGACT
>probe:Drosophila_2:1625454_at:583:461; Interrogation_Position=1049; Antisense; GATTACTGTTTGCTGGCTACAACGA
>probe:Drosophila_2:1625454_at:721:461; Interrogation_Position=1072; Antisense; GATTACACCGTCAACTTGTGGGACA
>probe:Drosophila_2:1625454_at:206:237; Interrogation_Position=1103; Antisense; AATCGGAAAGGGTCTGCCTGCTGTA
>probe:Drosophila_2:1625454_at:269:133; Interrogation_Position=1133; Antisense; ACGAGAACAAGGTGTCCTGCGTCCA
>probe:Drosophila_2:1625454_at:461:43; Interrogation_Position=1204; Antisense; ACCATACGGGTGTGGGCCTAAGCCA
>probe:Drosophila_2:1625454_at:723:203; Interrogation_Position=1223; Antisense; AAGCCATGTGGCACCTTATTGTTGG
>probe:Drosophila_2:1625454_at:107:75; Interrogation_Position=1263; Antisense; AGGACAGATGCCGTCTCGCTTTGTT
>probe:Drosophila_2:1625454_at:517:717; Interrogation_Position=1288; Antisense; TTCCCTCTCTTCTGATTTGTTTTTT
>probe:Drosophila_2:1625454_at:555:727; Interrogation_Position=1328; Antisense; TTGTGCATCGCATCTCTAGGATAGT
>probe:Drosophila_2:1625454_at:308:25; Interrogation_Position=1388; Antisense; ATATGTCTCATGTCGGGATTGCCAG
>probe:Drosophila_2:1625454_at:535:115; Interrogation_Position=1411; Antisense; AGCATGGATGTCTTGGTTACCGCAG
>probe:Drosophila_2:1625454_at:211:703; Interrogation_Position=1438; Antisense; TTATGCTTACTACCAGCTGCTGTAC
>probe:Drosophila_2:1625454_at:292:471; Interrogation_Position=990; Antisense; GTTCGCCAAGGAGAGCATCATCTTT

Paste this into a BLAST search page for me
ATCTTTGGCGTCAATTCGGTGGACTGATTACTGTTTGCTGGCTACAACGAGATTACACCGTCAACTTGTGGGACAAATCGGAAAGGGTCTGCCTGCTGTAACGAGAACAAGGTGTCCTGCGTCCAACCATACGGGTGTGGGCCTAAGCCAAAGCCATGTGGCACCTTATTGTTGGAGGACAGATGCCGTCTCGCTTTGTTTTCCCTCTCTTCTGATTTGTTTTTTTTGTGCATCGCATCTCTAGGATAGTATATGTCTCATGTCGGGATTGCCAGAGCATGGATGTCTTGGTTACCGCAGTTATGCTTACTACCAGCTGCTGTACGTTCGCCAAGGAGAGCATCATCTTT

Full Affymetrix probeset data:

Annotations for 1625454_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720