FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625455_at:

>probe:Drosophila_2:1625455_at:295:377; Interrogation_Position=157; Antisense; GAAGCAAACACAACAGCACACCGCA
>probe:Drosophila_2:1625455_at:363:159; Interrogation_Position=164; Antisense; ACACAACAGCACACCGCAGTTGCAG
>probe:Drosophila_2:1625455_at:83:95; Interrogation_Position=181; Antisense; AGTTGCAGCTCCTCTGCGCCTTTGT
>probe:Drosophila_2:1625455_at:171:281; Interrogation_Position=192; Antisense; CTCTGCGCCTTTGTGTGTGCTGTGT
>probe:Drosophila_2:1625455_at:155:597; Interrogation_Position=205; Antisense; TGTGTGCTGTGTGTCATTCCATTCC
>probe:Drosophila_2:1625455_at:604:9; Interrogation_Position=220; Antisense; ATTCCATTCCCGTCTGGGACAGGAG
>probe:Drosophila_2:1625455_at:285:557; Interrogation_Position=244; Antisense; GGACTGGCGGAGTCCTCACACCGAG
>probe:Drosophila_2:1625455_at:673:231; Interrogation_Position=324; Antisense; AATGACTTCATCAACCACCGGGCAC
>probe:Drosophila_2:1625455_at:693:129; Interrogation_Position=340; Antisense; ACCGGGCACTGGAAGCAGCCAGCGA
>probe:Drosophila_2:1625455_at:644:111; Interrogation_Position=374; Antisense; AGCAACAGCTCCCTTGCTGGGCTCA
>probe:Drosophila_2:1625455_at:289:273; Interrogation_Position=386; Antisense; CTTGCTGGGCTCACTTTTGGCAACG
>probe:Drosophila_2:1625455_at:708:691; Interrogation_Position=402; Antisense; TTGGCAACGCCACATTTTAGACTAC
>probe:Drosophila_2:1625455_at:539:673; Interrogation_Position=419; Antisense; TAGACTACAGTAGAGCCTCGACAAG
>probe:Drosophila_2:1625455_at:220:91; Interrogation_Position=427; Antisense; AGTAGAGCCTCGACAAGGCACACCG

Paste this into a BLAST search page for me
GAAGCAAACACAACAGCACACCGCAACACAACAGCACACCGCAGTTGCAGAGTTGCAGCTCCTCTGCGCCTTTGTCTCTGCGCCTTTGTGTGTGCTGTGTTGTGTGCTGTGTGTCATTCCATTCCATTCCATTCCCGTCTGGGACAGGAGGGACTGGCGGAGTCCTCACACCGAGAATGACTTCATCAACCACCGGGCACACCGGGCACTGGAAGCAGCCAGCGAAGCAACAGCTCCCTTGCTGGGCTCACTTGCTGGGCTCACTTTTGGCAACGTTGGCAACGCCACATTTTAGACTACTAGACTACAGTAGAGCCTCGACAAGAGTAGAGCCTCGACAAGGCACACCG

Full Affymetrix probeset data:

Annotations for 1625455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720