FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625457_at:

>probe:Drosophila_2:1625457_at:54:499; Interrogation_Position=116; Antisense; GTCTTATGCAACTTACGCAGGCAGT
>probe:Drosophila_2:1625457_at:52:569; Interrogation_Position=135; Antisense; GGCAGTAGCCACTCCCAATAATAAT
>probe:Drosophila_2:1625457_at:279:371; Interrogation_Position=186; Antisense; GAAGGCTGTGGTTCAGGTGCAACCT
>probe:Drosophila_2:1625457_at:681:1; Interrogation_Position=19; Antisense; ACAGTCGTTGCTTTTAACGTTCAGT
>probe:Drosophila_2:1625457_at:238:535; Interrogation_Position=201; Antisense; GGTGCAACCTGGAAATCCATCGGGA
>probe:Drosophila_2:1625457_at:258:525; Interrogation_Position=222; Antisense; GGGAAACAAGCCTGCAGTTGCCACA
>probe:Drosophila_2:1625457_at:428:539; Interrogation_Position=270; Antisense; GGTACCAGATCCCAAATGCCTGCAG
>probe:Drosophila_2:1625457_at:564:49; Interrogation_Position=285; Antisense; ATGCCTGCAGCCCTTGGACGTTGGT
>probe:Drosophila_2:1625457_at:667:627; Interrogation_Position=309; Antisense; TCCATGCCGCATGAGCCTAGAAAGG
>probe:Drosophila_2:1625457_at:597:173; Interrogation_Position=355; Antisense; AAAGCTTGCGAGACCTTCAAGTACG
>probe:Drosophila_2:1625457_at:614:511; Interrogation_Position=425; Antisense; GTGAGGAGGCTTGTATTCCCAAAAA
>probe:Drosophila_2:1625457_at:439:85; Interrogation_Position=449; Antisense; AGTGATCCATTGATGGCGGTCACAA
>probe:Drosophila_2:1625457_at:404:233; Interrogation_Position=63; Antisense; AATGCTTCTGCGGATGACCCAGTTT
>probe:Drosophila_2:1625457_at:641:329; Interrogation_Position=97; Antisense; GCGGCACTCGTTTTGCTAAGTCTTA

Paste this into a BLAST search page for me
GTCTTATGCAACTTACGCAGGCAGTGGCAGTAGCCACTCCCAATAATAATGAAGGCTGTGGTTCAGGTGCAACCTACAGTCGTTGCTTTTAACGTTCAGTGGTGCAACCTGGAAATCCATCGGGAGGGAAACAAGCCTGCAGTTGCCACAGGTACCAGATCCCAAATGCCTGCAGATGCCTGCAGCCCTTGGACGTTGGTTCCATGCCGCATGAGCCTAGAAAGGAAAGCTTGCGAGACCTTCAAGTACGGTGAGGAGGCTTGTATTCCCAAAAAAGTGATCCATTGATGGCGGTCACAAAATGCTTCTGCGGATGACCCAGTTTGCGGCACTCGTTTTGCTAAGTCTTA

Full Affymetrix probeset data:

Annotations for 1625457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720