Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625459_at:

>probe:Drosophila_2:1625459_at:357:425; Interrogation_Position=3413; Antisense; GAGAGCGATGAGCACTCCAGCAACT
>probe:Drosophila_2:1625459_at:71:97; Interrogation_Position=3459; Antisense; AGATCCAAATGCTCTTGGCCGAGGC
>probe:Drosophila_2:1625459_at:527:613; Interrogation_Position=3501; Antisense; TGAACAGGGCGCTCTACCTGCTGGA
>probe:Drosophila_2:1625459_at:235:103; Interrogation_Position=3630; Antisense; AGAGCTTGCAGTACCTGTGCGATCA
>probe:Drosophila_2:1625459_at:391:597; Interrogation_Position=3645; Antisense; TGTGCGATCACGTCTTTTGGAAGGA
>probe:Drosophila_2:1625459_at:696:137; Interrogation_Position=3687; Antisense; ACGAGTTCCTCTTCAATCTTTATAA
>probe:Drosophila_2:1625459_at:164:51; Interrogation_Position=3735; Antisense; ATGCCGATGTCTTCAGGGAGGCCAT
>probe:Drosophila_2:1625459_at:38:441; Interrogation_Position=3752; Antisense; GAGGCCATCATCTGTTCCCGTAACA
>probe:Drosophila_2:1625459_at:675:491; Interrogation_Position=3771; Antisense; GTAACAAGCCCTATTTCGACAGCAA
>probe:Drosophila_2:1625459_at:160:323; Interrogation_Position=3868; Antisense; GCCCACGCCTGAAGTGCACTTGAAT
>probe:Drosophila_2:1625459_at:427:615; Interrogation_Position=3888; Antisense; TGAATGGCTAGAACCAACCGCCTAC
>probe:Drosophila_2:1625459_at:250:303; Interrogation_Position=3905; Antisense; CCGCCTACCGTCAATGTTAGTCAAT
>probe:Drosophila_2:1625459_at:625:249; Interrogation_Position=3926; Antisense; CAATTTTTGATAGCCATCGCGTTCC
>probe:Drosophila_2:1625459_at:381:45; Interrogation_Position=3941; Antisense; ATCGCGTTCCTTGTTACTTGTATGT

Paste this into a BLAST search page for me
GAGAGCGATGAGCACTCCAGCAACTAGATCCAAATGCTCTTGGCCGAGGCTGAACAGGGCGCTCTACCTGCTGGAAGAGCTTGCAGTACCTGTGCGATCATGTGCGATCACGTCTTTTGGAAGGAACGAGTTCCTCTTCAATCTTTATAAATGCCGATGTCTTCAGGGAGGCCATGAGGCCATCATCTGTTCCCGTAACAGTAACAAGCCCTATTTCGACAGCAAGCCCACGCCTGAAGTGCACTTGAATTGAATGGCTAGAACCAACCGCCTACCCGCCTACCGTCAATGTTAGTCAATCAATTTTTGATAGCCATCGCGTTCCATCGCGTTCCTTGTTACTTGTATGT

Full Affymetrix probeset data:

Annotations for 1625459_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime