Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625460_s_at:

>probe:Drosophila_2:1625460_s_at:292:573; Interrogation_Position=129; Antisense; GGCTCCGCCAATTGGACACTGCAAA
>probe:Drosophila_2:1625460_s_at:525:653; Interrogation_Position=154; Antisense; TCAAGTATCCGCAGCCACGTGACTC
>probe:Drosophila_2:1625460_s_at:59:415; Interrogation_Position=207; Antisense; GAGCCCAAGATGTCCCTGTCGTACA
>probe:Drosophila_2:1625460_s_at:458:281; Interrogation_Position=222; Antisense; CTGTCGTACACCTTCAACGTAGTGG
>probe:Drosophila_2:1625460_s_at:558:535; Interrogation_Position=246; Antisense; GGTCGTTGCCAGAGCCATTCCAATT
>probe:Drosophila_2:1625460_s_at:273:275; Interrogation_Position=260; Antisense; CCATTCCAATTGACTTTAATCCCCA
>probe:Drosophila_2:1625460_s_at:678:695; Interrogation_Position=274; Antisense; TTTAATCCCCAAAACTTGTGCCCAT
>probe:Drosophila_2:1625460_s_at:149:511; Interrogation_Position=312; Antisense; GTGCAACAGTTTGTGTTATCTCATA
>probe:Drosophila_2:1625460_s_at:404:537; Interrogation_Position=34; Antisense; GGTCTCTTGGATACGCAAACGTGAT
>probe:Drosophila_2:1625460_s_at:334:249; Interrogation_Position=345; Antisense; CAATGATTCACATACGGAGCTTGAT
>probe:Drosophila_2:1625460_s_at:710:179; Interrogation_Position=374; Antisense; AAAATTTCGACCATTATCCGGCACT
>probe:Drosophila_2:1625460_s_at:243:47; Interrogation_Position=389; Antisense; ATCCGGCACTGCAAAGTGGGCCAAT
>probe:Drosophila_2:1625460_s_at:608:513; Interrogation_Position=54; Antisense; GTGATCTGCATATACTCACCGCCGG
>probe:Drosophila_2:1625460_s_at:351:663; Interrogation_Position=89; Antisense; TACACATCCGATCAGCGTTTTCAGG

Paste this into a BLAST search page for me
GGCTCCGCCAATTGGACACTGCAAATCAAGTATCCGCAGCCACGTGACTCGAGCCCAAGATGTCCCTGTCGTACACTGTCGTACACCTTCAACGTAGTGGGGTCGTTGCCAGAGCCATTCCAATTCCATTCCAATTGACTTTAATCCCCATTTAATCCCCAAAACTTGTGCCCATGTGCAACAGTTTGTGTTATCTCATAGGTCTCTTGGATACGCAAACGTGATCAATGATTCACATACGGAGCTTGATAAAATTTCGACCATTATCCGGCACTATCCGGCACTGCAAAGTGGGCCAATGTGATCTGCATATACTCACCGCCGGTACACATCCGATCAGCGTTTTCAGG

Full Affymetrix probeset data:

Annotations for 1625460_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime