FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625463_at:

>probe:Drosophila_2:1625463_at:295:65; Interrogation_Position=1580; Antisense; ATGGTCCGTGGATTCCGCGACAGGA
>probe:Drosophila_2:1625463_at:458:297; Interrogation_Position=1607; Antisense; CGCGGATAATACTGACCCCGACTAT
>probe:Drosophila_2:1625463_at:217:269; Interrogation_Position=1705; Antisense; CAGGAGCGGCTCAAGCGGGCTATAT
>probe:Drosophila_2:1625463_at:467:21; Interrogation_Position=1726; Antisense; ATATATATAGATCGGTCCTCGCGCG
>probe:Drosophila_2:1625463_at:654:633; Interrogation_Position=1769; Antisense; TCGCCAGTCTGAATGGCATCTACTG
>probe:Drosophila_2:1625463_at:24:347; Interrogation_Position=1784; Antisense; GCATCTACTGGTGTGTGTTCTACGA
>probe:Drosophila_2:1625463_at:402:429; Interrogation_Position=1807; Antisense; GAGTATCTATAAGGACTACGACGAC
>probe:Drosophila_2:1625463_at:448:409; Interrogation_Position=1826; Antisense; GACGACTGTGCCCTGTAAATACTTT
>probe:Drosophila_2:1625463_at:588:663; Interrogation_Position=1841; Antisense; TAAATACTTTCGCTAGCTCTCTGGC
>probe:Drosophila_2:1625463_at:179:639; Interrogation_Position=1860; Antisense; TCTGGCACTCCATCCGAGTGTTAAA
>probe:Drosophila_2:1625463_at:385:177; Interrogation_Position=1882; Antisense; AAACGTTGATTGTTCGCATATATCG
>probe:Drosophila_2:1625463_at:700:709; Interrogation_Position=1924; Antisense; TTAATCTTAAGCTTTCACGCACAAG
>probe:Drosophila_2:1625463_at:61:711; Interrogation_Position=1937; Antisense; TTCACGCACAAGCTTTAAGTCAATG
>probe:Drosophila_2:1625463_at:284:511; Interrogation_Position=2082; Antisense; GTGACGTAGTAGCTGATGTAGCCTA

Paste this into a BLAST search page for me
ATGGTCCGTGGATTCCGCGACAGGACGCGGATAATACTGACCCCGACTATCAGGAGCGGCTCAAGCGGGCTATATATATATATAGATCGGTCCTCGCGCGTCGCCAGTCTGAATGGCATCTACTGGCATCTACTGGTGTGTGTTCTACGAGAGTATCTATAAGGACTACGACGACGACGACTGTGCCCTGTAAATACTTTTAAATACTTTCGCTAGCTCTCTGGCTCTGGCACTCCATCCGAGTGTTAAAAAACGTTGATTGTTCGCATATATCGTTAATCTTAAGCTTTCACGCACAAGTTCACGCACAAGCTTTAAGTCAATGGTGACGTAGTAGCTGATGTAGCCTA

Full Affymetrix probeset data:

Annotations for 1625463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720