Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625464_at:

>probe:Drosophila_2:1625464_at:344:233; Interrogation_Position=3128; Antisense; AATGCACCACGTATTTGCTGCTCAA
>probe:Drosophila_2:1625464_at:583:19; Interrogation_Position=3140; Antisense; ATTTGCTGCTCAACTCTCAGTTTTT
>probe:Drosophila_2:1625464_at:205:649; Interrogation_Position=3156; Antisense; TCAGTTTTTCTCTCCTCTTTTATTT
>probe:Drosophila_2:1625464_at:32:57; Interrogation_Position=3208; Antisense; ATGAGCCAATCGATTGGAACCTCTT
>probe:Drosophila_2:1625464_at:140:561; Interrogation_Position=3223; Antisense; GGAACCTCTTTATTCTCTATCGTTT
>probe:Drosophila_2:1625464_at:543:9; Interrogation_Position=3282; Antisense; ATTCCTAACATGCACTACTCTGCTA
>probe:Drosophila_2:1625464_at:552:603; Interrogation_Position=3339; Antisense; TGTTGACCCGGAAACGCACGCGTAT
>probe:Drosophila_2:1625464_at:567:373; Interrogation_Position=3381; Antisense; GAAGTATCCAAAACACTGTGAGCAT
>probe:Drosophila_2:1625464_at:622:469; Interrogation_Position=3429; Antisense; GTTGCGAGGAATTATGAATGCCACA
>probe:Drosophila_2:1625464_at:310:369; Interrogation_Position=3444; Antisense; GAATGCCACATGATGATGACCGACC
>probe:Drosophila_2:1625464_at:225:51; Interrogation_Position=3459; Antisense; ATGACCGACCCCAGAATGCGAAAGT
>probe:Drosophila_2:1625464_at:18:89; Interrogation_Position=3481; Antisense; AGTCACTCACTTATTTACCTCTTTT
>probe:Drosophila_2:1625464_at:155:693; Interrogation_Position=3504; Antisense; TTTCGCCCCTAATAGAAAGTCTAGT
>probe:Drosophila_2:1625464_at:216:17; Interrogation_Position=3539; Antisense; ATTTGTTTTTGAGTTGGGACGCTAG

Paste this into a BLAST search page for me
AATGCACCACGTATTTGCTGCTCAAATTTGCTGCTCAACTCTCAGTTTTTTCAGTTTTTCTCTCCTCTTTTATTTATGAGCCAATCGATTGGAACCTCTTGGAACCTCTTTATTCTCTATCGTTTATTCCTAACATGCACTACTCTGCTATGTTGACCCGGAAACGCACGCGTATGAAGTATCCAAAACACTGTGAGCATGTTGCGAGGAATTATGAATGCCACAGAATGCCACATGATGATGACCGACCATGACCGACCCCAGAATGCGAAAGTAGTCACTCACTTATTTACCTCTTTTTTTCGCCCCTAATAGAAAGTCTAGTATTTGTTTTTGAGTTGGGACGCTAG

Full Affymetrix probeset data:

Annotations for 1625464_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime