Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625465_a_at:

>probe:Drosophila_2:1625465_a_at:281:281; Interrogation_Position=1004; Antisense; CTCATTTGGCTTGTTGTGTTTGTAA
>probe:Drosophila_2:1625465_a_at:524:725; Interrogation_Position=522; Antisense; TTGAGCTGGTCTGTGTCATTGGCAA
>probe:Drosophila_2:1625465_a_at:297:237; Interrogation_Position=567; Antisense; AATCGCAGGCCATGGACTATGTCTT
>probe:Drosophila_2:1625465_a_at:410:713; Interrogation_Position=590; Antisense; TTCGGGTATTCGGTGGCCCAGGATA
>probe:Drosophila_2:1625465_a_at:352:139; Interrogation_Position=645; Antisense; ACGGTGGTCAGTTCCTTATGGGCAA
>probe:Drosophila_2:1625465_a_at:103:219; Interrogation_Position=668; Antisense; AAGTCGATGGACACTTTTCTGCCGC
>probe:Drosophila_2:1625465_a_at:332:287; Interrogation_Position=719; Antisense; CTGGTGCCGGATGTTTACAACTTGA
>probe:Drosophila_2:1625465_a_at:728:601; Interrogation_Position=747; Antisense; TGAAAACCTGGGTCAACGGCGTGGA
>probe:Drosophila_2:1625465_a_at:603:565; Interrogation_Position=782; Antisense; GGCAATACCGGCAACTTGATCTTCA
>probe:Drosophila_2:1625465_a_at:123:443; Interrogation_Position=815; Antisense; GATGTGATCAATCGTCTGTCGCAGA
>probe:Drosophila_2:1625465_a_at:415:25; Interrogation_Position=866; Antisense; ATAGTCACCGGAACGCCCAAGGGCG
>probe:Drosophila_2:1625465_a_at:131:223; Interrogation_Position=884; Antisense; AAGGGCGTGGGCATGCATCGCACTC
>probe:Drosophila_2:1625465_a_at:339:713; Interrogation_Position=921; Antisense; TTCAGCCCGGTGATGTCGTGCAGTC
>probe:Drosophila_2:1625465_a_at:365:583; Interrogation_Position=984; Antisense; TGGCTCCCTAAGATTGTCAACTCAT

Paste this into a BLAST search page for me
CTCATTTGGCTTGTTGTGTTTGTAATTGAGCTGGTCTGTGTCATTGGCAAAATCGCAGGCCATGGACTATGTCTTTTCGGGTATTCGGTGGCCCAGGATAACGGTGGTCAGTTCCTTATGGGCAAAAGTCGATGGACACTTTTCTGCCGCCTGGTGCCGGATGTTTACAACTTGATGAAAACCTGGGTCAACGGCGTGGAGGCAATACCGGCAACTTGATCTTCAGATGTGATCAATCGTCTGTCGCAGAATAGTCACCGGAACGCCCAAGGGCGAAGGGCGTGGGCATGCATCGCACTCTTCAGCCCGGTGATGTCGTGCAGTCTGGCTCCCTAAGATTGTCAACTCAT

Full Affymetrix probeset data:

Annotations for 1625465_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime