FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625466_at:

>probe:Drosophila_2:1625466_at:429:417; Interrogation_Position=443; Antisense; GAGCTCTTCACTCACCTAAAGATGG
>probe:Drosophila_2:1625466_at:61:563; Interrogation_Position=481; Antisense; GGAACTGCTCGAGTCCTGGAACTTC
>probe:Drosophila_2:1625466_at:362:153; Interrogation_Position=509; Antisense; ACATGCGTCGTCTTCTGCTTGGACT
>probe:Drosophila_2:1625466_at:626:273; Interrogation_Position=526; Antisense; CTTGGACTCGCAGTTCATGGTGGAC
>probe:Drosophila_2:1625466_at:234:299; Interrogation_Position=580; Antisense; CGCGCTCAGTGTGATGGCCAACATG
>probe:Drosophila_2:1625466_at:730:413; Interrogation_Position=628; Antisense; GACCAAAGTGGATCTGCTGAGCAGC
>probe:Drosophila_2:1625466_at:269:427; Interrogation_Position=671; Antisense; GAGATGTACCTGGAACCGGATGCCC
>probe:Drosophila_2:1625466_at:277:381; Interrogation_Position=683; Antisense; GAACCGGATGCCCACAGTCTGATGG
>probe:Drosophila_2:1625466_at:569:307; Interrogation_Position=717; Antisense; CCATCGGGACTGGTTTTGGCGAGAA
>probe:Drosophila_2:1625466_at:142:173; Interrogation_Position=748; Antisense; AAAGCTTACGCAGGCTATTGGCGCG
>probe:Drosophila_2:1625466_at:537:3; Interrogation_Position=764; Antisense; ATTGGCGCGCTAATTGAGGATTTCA
>probe:Drosophila_2:1625466_at:629:425; Interrogation_Position=796; Antisense; GAGATTTTTCCCGTTGGATTCCCAG
>probe:Drosophila_2:1625466_at:616:517; Interrogation_Position=833; Antisense; GTGGGCGATCTTCTGCTACAAATTG
>probe:Drosophila_2:1625466_at:46:155; Interrogation_Position=858; Antisense; ACAGTATCTTGCAGTACGGCGAGGA

Paste this into a BLAST search page for me
GAGCTCTTCACTCACCTAAAGATGGGGAACTGCTCGAGTCCTGGAACTTCACATGCGTCGTCTTCTGCTTGGACTCTTGGACTCGCAGTTCATGGTGGACCGCGCTCAGTGTGATGGCCAACATGGACCAAAGTGGATCTGCTGAGCAGCGAGATGTACCTGGAACCGGATGCCCGAACCGGATGCCCACAGTCTGATGGCCATCGGGACTGGTTTTGGCGAGAAAAAGCTTACGCAGGCTATTGGCGCGATTGGCGCGCTAATTGAGGATTTCAGAGATTTTTCCCGTTGGATTCCCAGGTGGGCGATCTTCTGCTACAAATTGACAGTATCTTGCAGTACGGCGAGGA

Full Affymetrix probeset data:

Annotations for 1625466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720