FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625467_at:

>probe:Drosophila_2:1625467_at:588:729; Interrogation_Position=1009; Antisense; TTGGCCATTGCTCCCATTAACAGGG
>probe:Drosophila_2:1625467_at:178:543; Interrogation_Position=1033; Antisense; GGATTTTGGGTACTCGGCGATATCT
>probe:Drosophila_2:1625467_at:401:327; Interrogation_Position=1049; Antisense; GCGATATCTTTCTGCGCCGATACTA
>probe:Drosophila_2:1625467_at:496:549; Interrogation_Position=544; Antisense; GGAGTCTTGTCCTGGTCCAATACGA
>probe:Drosophila_2:1625467_at:16:129; Interrogation_Position=570; Antisense; ACCATTTCTGGAACTTCTGTGCGCA
>probe:Drosophila_2:1625467_at:48:717; Interrogation_Position=584; Antisense; TTCTGTGCGCACAACGATTGCTTGA
>probe:Drosophila_2:1625467_at:343:617; Interrogation_Position=695; Antisense; TGCACTATGTGCCAGTAAGCCAATG
>probe:Drosophila_2:1625467_at:505:311; Interrogation_Position=713; Antisense; GCCAATGGCATACGTGGAGTCTTCA
>probe:Drosophila_2:1625467_at:109:701; Interrogation_Position=791; Antisense; TTTTGGACACGGGAACATCACTGGT
>probe:Drosophila_2:1625467_at:610:641; Interrogation_Position=816; Antisense; TCTGGTGCCGCAACAAACATATCAT
>probe:Drosophila_2:1625467_at:59:35; Interrogation_Position=836; Antisense; ATCATAACCTGCTGAATACCCTATC
>probe:Drosophila_2:1625467_at:624:551; Interrogation_Position=934; Antisense; GGAGACAAGGTATTTCCCCTAACAT
>probe:Drosophila_2:1625467_at:274:719; Interrogation_Position=947; Antisense; TTCCCCTAACATCCAGCGATTATAT
>probe:Drosophila_2:1625467_at:458:175; Interrogation_Position=994; Antisense; AAACCAGCGTGTGTTTTGGCCATTG

Paste this into a BLAST search page for me
TTGGCCATTGCTCCCATTAACAGGGGGATTTTGGGTACTCGGCGATATCTGCGATATCTTTCTGCGCCGATACTAGGAGTCTTGTCCTGGTCCAATACGAACCATTTCTGGAACTTCTGTGCGCATTCTGTGCGCACAACGATTGCTTGATGCACTATGTGCCAGTAAGCCAATGGCCAATGGCATACGTGGAGTCTTCATTTTGGACACGGGAACATCACTGGTTCTGGTGCCGCAACAAACATATCATATCATAACCTGCTGAATACCCTATCGGAGACAAGGTATTTCCCCTAACATTTCCCCTAACATCCAGCGATTATATAAACCAGCGTGTGTTTTGGCCATTG

Full Affymetrix probeset data:

Annotations for 1625467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720