Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625468_at:

>probe:Drosophila_2:1625468_at:387:1; Interrogation_Position=223; Antisense; AGGTGTTGGGACTGAAGCCCTTCCA
>probe:Drosophila_2:1625468_at:451:275; Interrogation_Position=242; Antisense; CTTCCAGGTGTCTTGCGATGCAGAG
>probe:Drosophila_2:1625468_at:558:141; Interrogation_Position=276; Antisense; ACTGGATGGACTGTGATGGCCCGCC
>probe:Drosophila_2:1625468_at:197:187; Interrogation_Position=309; Antisense; AACAAGTTGAACTTCTTCCGCAGCT
>probe:Drosophila_2:1625468_at:69:159; Interrogation_Position=343; Antisense; ACAAAAACGGCTTCGGGCAGCTCGA
>probe:Drosophila_2:1625468_at:203:551; Interrogation_Position=369; Antisense; GGAGATTTCTTCATTGGCTTGGACA
>probe:Drosophila_2:1625468_at:406:31; Interrogation_Position=405; Antisense; ATAACTAAGTCACAGCCCCATGAGT
>probe:Drosophila_2:1625468_at:630:399; Interrogation_Position=457; Antisense; GACAGACACGATATGCGCATTACGA
>probe:Drosophila_2:1625468_at:409:139; Interrogation_Position=527; Antisense; ACTGGGCGAATTTACCGGCGACGCA
>probe:Drosophila_2:1625468_at:26:253; Interrogation_Position=579; Antisense; CAAAACTTCTCCACTTTCGATAGGG
>probe:Drosophila_2:1625468_at:213:267; Interrogation_Position=674; Antisense; CAGTAATCTATTCGGCATCTATGTG
>probe:Drosophila_2:1625468_at:88:223; Interrogation_Position=729; Antisense; AAGGGCATCGTCTGGCATTCTTGGC
>probe:Drosophila_2:1625468_at:34:577; Interrogation_Position=751; Antisense; GGCGCACTGAGAGTTATTCCTACAA
>probe:Drosophila_2:1625468_at:634:589; Interrogation_Position=790; Antisense; TGGTTCGACCGAAATGCCATTGCTC

Paste this into a BLAST search page for me
AGGTGTTGGGACTGAAGCCCTTCCACTTCCAGGTGTCTTGCGATGCAGAGACTGGATGGACTGTGATGGCCCGCCAACAAGTTGAACTTCTTCCGCAGCTACAAAAACGGCTTCGGGCAGCTCGAGGAGATTTCTTCATTGGCTTGGACAATAACTAAGTCACAGCCCCATGAGTGACAGACACGATATGCGCATTACGAACTGGGCGAATTTACCGGCGACGCACAAAACTTCTCCACTTTCGATAGGGCAGTAATCTATTCGGCATCTATGTGAAGGGCATCGTCTGGCATTCTTGGCGGCGCACTGAGAGTTATTCCTACAATGGTTCGACCGAAATGCCATTGCTC

Full Affymetrix probeset data:

Annotations for 1625468_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime