FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625469_at:

>probe:Drosophila_2:1625469_at:609:509; Interrogation_Position=2074; Antisense; GTGAACAATACCACTCAAACGGACG
>probe:Drosophila_2:1625469_at:479:93; Interrogation_Position=2146; Antisense; AGTTCACCAGACTTTACACCCAATC
>probe:Drosophila_2:1625469_at:146:235; Interrogation_Position=2243; Antisense; AATCCAATCTCGATTCGCGACCAAA
>probe:Drosophila_2:1625469_at:472:493; Interrogation_Position=2281; Antisense; GTAATAACTCGTAGAGCGCCCGATC
>probe:Drosophila_2:1625469_at:289:303; Interrogation_Position=2309; Antisense; CCGTTCGTTGTGACGTGGAGCCCAA
>probe:Drosophila_2:1625469_at:425:585; Interrogation_Position=2324; Antisense; TGGAGCCCAAGGTGCGTTTGAAGTT
>probe:Drosophila_2:1625469_at:504:371; Interrogation_Position=2343; Antisense; GAAGTTGCTCAAAACCGTATTGGTG
>probe:Drosophila_2:1625469_at:44:527; Interrogation_Position=2367; Antisense; GGGAATGGTCCAGATCGCTGTTATA
>probe:Drosophila_2:1625469_at:400:15; Interrogation_Position=2391; Antisense; ATTAGTTCTCATCATGGCCATCGGA
>probe:Drosophila_2:1625469_at:712:41; Interrogation_Position=2410; Antisense; ATCGGATCTCCGGATATTATCTGCT
>probe:Drosophila_2:1625469_at:279:339; Interrogation_Position=2432; Antisense; GCTAAGCTACACAACCATCGAAATA
>probe:Drosophila_2:1625469_at:565:303; Interrogation_Position=2565; Antisense; CCGGATTCGGTGTTTGATTTCACAT
>probe:Drosophila_2:1625469_at:88:691; Interrogation_Position=2603; Antisense; TATTGTTTTCTTACTCGGGCCCAAG
>probe:Drosophila_2:1625469_at:475:299; Interrogation_Position=2622; Antisense; CCCAAGCGAAGCCACGTCAAAGTTA

Paste this into a BLAST search page for me
GTGAACAATACCACTCAAACGGACGAGTTCACCAGACTTTACACCCAATCAATCCAATCTCGATTCGCGACCAAAGTAATAACTCGTAGAGCGCCCGATCCCGTTCGTTGTGACGTGGAGCCCAATGGAGCCCAAGGTGCGTTTGAAGTTGAAGTTGCTCAAAACCGTATTGGTGGGGAATGGTCCAGATCGCTGTTATAATTAGTTCTCATCATGGCCATCGGAATCGGATCTCCGGATATTATCTGCTGCTAAGCTACACAACCATCGAAATACCGGATTCGGTGTTTGATTTCACATTATTGTTTTCTTACTCGGGCCCAAGCCCAAGCGAAGCCACGTCAAAGTTA

Full Affymetrix probeset data:

Annotations for 1625469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720