Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625472_at:

>probe:Drosophila_2:1625472_at:154:353; Interrogation_Position=111; Antisense; GCAGCGGGCGAATCAGCCGAATCAT
>probe:Drosophila_2:1625472_at:540:365; Interrogation_Position=129; Antisense; GAATCATGGCAAGGCCCGGAGTCAG
>probe:Drosophila_2:1625472_at:711:569; Interrogation_Position=156; Antisense; GGCTCACTCGAATCCGTACGAGGTG
>probe:Drosophila_2:1625472_at:567:517; Interrogation_Position=178; Antisense; GTGGTGGCCGATGCGCAGACCTACC
>probe:Drosophila_2:1625472_at:603:45; Interrogation_Position=203; Antisense; ATCCCGGCCAGCAGATATCGGTGGT
>probe:Drosophila_2:1625472_at:234:95; Interrogation_Position=215; Antisense; AGATATCGGTGGTCATCTACCCGCA
>probe:Drosophila_2:1625472_at:37:713; Interrogation_Position=25; Antisense; TTCAAGTGGTTGTCGCTGGAGCTGC
>probe:Drosophila_2:1625472_at:32:531; Interrogation_Position=264; Antisense; GGGATTCTTCCTGCAGGCGCGTGAT
>probe:Drosophila_2:1625472_at:246:323; Interrogation_Position=280; Antisense; GCGCGTGATGCCAACTCGAACGAGT
>probe:Drosophila_2:1625472_at:583:351; Interrogation_Position=321; Antisense; GCAGAGCGAGAACACCAAGACCATT
>probe:Drosophila_2:1625472_at:258:211; Interrogation_Position=337; Antisense; AAGACCATTCCAGAGTGCTCGGCCA
>probe:Drosophila_2:1625472_at:65:15; Interrogation_Position=361; Antisense; ATTACGCACTCGGACAACCGGGACA
>probe:Drosophila_2:1625472_at:194:159; Interrogation_Position=374; Antisense; ACAACCGGGACAAGCTGGGCGCCAA
>probe:Drosophila_2:1625472_at:128:209; Interrogation_Position=397; Antisense; AAGCTCATCTGGAAGGCACCGCAAA

Paste this into a BLAST search page for me
GCAGCGGGCGAATCAGCCGAATCATGAATCATGGCAAGGCCCGGAGTCAGGGCTCACTCGAATCCGTACGAGGTGGTGGTGGCCGATGCGCAGACCTACCATCCCGGCCAGCAGATATCGGTGGTAGATATCGGTGGTCATCTACCCGCATTCAAGTGGTTGTCGCTGGAGCTGCGGGATTCTTCCTGCAGGCGCGTGATGCGCGTGATGCCAACTCGAACGAGTGCAGAGCGAGAACACCAAGACCATTAAGACCATTCCAGAGTGCTCGGCCAATTACGCACTCGGACAACCGGGACAACAACCGGGACAAGCTGGGCGCCAAAAGCTCATCTGGAAGGCACCGCAAA

Full Affymetrix probeset data:

Annotations for 1625472_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime