FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625473_at:

>probe:Drosophila_2:1625473_at:393:319; Interrogation_Position=2583; Antisense; GCCGAGAGCTGTCCGAACCTGAAGA
>probe:Drosophila_2:1625473_at:107:203; Interrogation_Position=2598; Antisense; AACCTGAAGAAGCTCAGCCTGCGCA
>probe:Drosophila_2:1625473_at:165:623; Interrogation_Position=2617; Antisense; TGCGCAGCTGCGACATGATCACGGA
>probe:Drosophila_2:1625473_at:396:345; Interrogation_Position=2661; Antisense; GCATATTATTGTCGCGGTCTCCAGC
>probe:Drosophila_2:1625473_at:389:143; Interrogation_Position=2687; Antisense; ACTGAATATCCAGGACTGTCCGGTT
>probe:Drosophila_2:1625473_at:340:143; Interrogation_Position=2701; Antisense; ACTGTCCGGTTTCCATCGAGGGCTA
>probe:Drosophila_2:1625473_at:29:207; Interrogation_Position=2748; Antisense; AAGCGCTGCATCATCGAACACACAA
>probe:Drosophila_2:1625473_at:260:99; Interrogation_Position=2789; Antisense; AGATGTTCCATAGCCGGCGGTAGAC
>probe:Drosophila_2:1625473_at:711:327; Interrogation_Position=2805; Antisense; GCGGTAGACACCACAAAGCACAGAG
>probe:Drosophila_2:1625473_at:385:439; Interrogation_Position=2827; Antisense; GAGGCAGGCCATATGAGCACAGATA
>probe:Drosophila_2:1625473_at:57:667; Interrogation_Position=2926; Antisense; TACACGGACTTTTGGGTCCTCAAGT
>probe:Drosophila_2:1625473_at:644:211; Interrogation_Position=2947; Antisense; AAGTCCCCAAGTCTTAGTTCAATGA
>probe:Drosophila_2:1625473_at:653:5; Interrogation_Position=3009; Antisense; ATTGTTCTCTGTAATCAGCCACCAC
>probe:Drosophila_2:1625473_at:511:127; Interrogation_Position=3029; Antisense; ACCACTTTGCCCGAGCTAAATGAGA

Paste this into a BLAST search page for me
GCCGAGAGCTGTCCGAACCTGAAGAAACCTGAAGAAGCTCAGCCTGCGCATGCGCAGCTGCGACATGATCACGGAGCATATTATTGTCGCGGTCTCCAGCACTGAATATCCAGGACTGTCCGGTTACTGTCCGGTTTCCATCGAGGGCTAAAGCGCTGCATCATCGAACACACAAAGATGTTCCATAGCCGGCGGTAGACGCGGTAGACACCACAAAGCACAGAGGAGGCAGGCCATATGAGCACAGATATACACGGACTTTTGGGTCCTCAAGTAAGTCCCCAAGTCTTAGTTCAATGAATTGTTCTCTGTAATCAGCCACCACACCACTTTGCCCGAGCTAAATGAGA

Full Affymetrix probeset data:

Annotations for 1625473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720