FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625478_at:

>probe:Drosophila_2:1625478_at:563:227; Interrogation_Position=2100; Antisense; AATGGCAGCGGCACCTCTGTCCAGT
>probe:Drosophila_2:1625478_at:647:625; Interrogation_Position=2125; Antisense; TGCCCGTTTCTAGTGAGGCCAACAA
>probe:Drosophila_2:1625478_at:622:409; Interrogation_Position=2235; Antisense; GACGACTACGATCCCTTCGAGATAA
>probe:Drosophila_2:1625478_at:505:455; Interrogation_Position=2255; Antisense; GATAATGCTCAAGCGGCCAGTCATC
>probe:Drosophila_2:1625478_at:379:267; Interrogation_Position=2272; Antisense; CAGTCATCACCTTGTACAGCCAAAA
>probe:Drosophila_2:1625478_at:449:613; Interrogation_Position=2299; Antisense; TGAAGGGCCTGAAGGATTTGCTGCT
>probe:Drosophila_2:1625478_at:346:723; Interrogation_Position=2316; Antisense; TTGCTGCTGGCCGAAAAGCTGAACA
>probe:Drosophila_2:1625478_at:229:387; Interrogation_Position=2328; Antisense; GAAAAGCTGAACACCCACGCTATTT
>probe:Drosophila_2:1625478_at:368:71; Interrogation_Position=2370; Antisense; CAGTCGGTGGCCTCTCGAAAGGTTC
>probe:Drosophila_2:1625478_at:359:389; Interrogation_Position=2405; Antisense; GAAACATTCGGCCACAATTTCAGCC
>probe:Drosophila_2:1625478_at:77:95; Interrogation_Position=2451; Antisense; AGTTCCGGCGACAGTGTCCTGAGCG
>probe:Drosophila_2:1625478_at:355:89; Interrogation_Position=2507; Antisense; AGTCACCGGTGGAGCGTCCTTGGCA
>probe:Drosophila_2:1625478_at:386:729; Interrogation_Position=2526; Antisense; TTGGCATCATCGTCCCTAGGAGGAG
>probe:Drosophila_2:1625478_at:251:77; Interrogation_Position=2546; Antisense; AGGAGATTCTATAGCCGCATCACGC

Paste this into a BLAST search page for me
AATGGCAGCGGCACCTCTGTCCAGTTGCCCGTTTCTAGTGAGGCCAACAAGACGACTACGATCCCTTCGAGATAAGATAATGCTCAAGCGGCCAGTCATCCAGTCATCACCTTGTACAGCCAAAATGAAGGGCCTGAAGGATTTGCTGCTTTGCTGCTGGCCGAAAAGCTGAACAGAAAAGCTGAACACCCACGCTATTTCAGTCGGTGGCCTCTCGAAAGGTTCGAAACATTCGGCCACAATTTCAGCCAGTTCCGGCGACAGTGTCCTGAGCGAGTCACCGGTGGAGCGTCCTTGGCATTGGCATCATCGTCCCTAGGAGGAGAGGAGATTCTATAGCCGCATCACGC

Full Affymetrix probeset data:

Annotations for 1625478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720