Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625480_at:

>probe:Drosophila_2:1625480_at:523:341; Interrogation_Position=1305; Antisense; GCTATCAGCGAGAGATACCCACCTT
>probe:Drosophila_2:1625480_at:411:633; Interrogation_Position=1346; Antisense; TCGCATTTATCCACGGGTGCGGCCA
>probe:Drosophila_2:1625480_at:532:137; Interrogation_Position=1373; Antisense; ACGAGCTCGGGATCCAACAGTTCGA
>probe:Drosophila_2:1625480_at:406:433; Interrogation_Position=1396; Antisense; GAGGACCAACCTCAATGGCAAGGCG
>probe:Drosophila_2:1625480_at:201:251; Interrogation_Position=1422; Antisense; CAACGACGGGAGTGCCAAGGGATCA
>probe:Drosophila_2:1625480_at:260:473; Interrogation_Position=1459; Antisense; GTTTATGGGAATGCCGCTGTTCACC
>probe:Drosophila_2:1625480_at:134:123; Interrogation_Position=1504; Antisense; AGCCGCCAATTTGCTGATGTCCGAT
>probe:Drosophila_2:1625480_at:17:419; Interrogation_Position=1570; Antisense; GAGCTGAGAGCTGAACCCTGGTCAA
>probe:Drosophila_2:1625480_at:100:529; Interrogation_Position=1605; Antisense; GGGAGAGCAGCCATCAAGCATAGAA
>probe:Drosophila_2:1625480_at:118:15; Interrogation_Position=1711; Antisense; ATTACTAAGCAAGCAGCCGAGGCTG
>probe:Drosophila_2:1625480_at:625:287; Interrogation_Position=1777; Antisense; CGGATTCTTACCATGACACCCCAAG
>probe:Drosophila_2:1625480_at:463:47; Interrogation_Position=1803; Antisense; ATCCTTCATCAGCAGTGCGTAGCTT
>probe:Drosophila_2:1625480_at:359:709; Interrogation_Position=1827; Antisense; TTAAGCGTTCTTATGTTCGTGTGTT
>probe:Drosophila_2:1625480_at:308:637; Interrogation_Position=1843; Antisense; TCGTGTGTTTATATGTGCCCAACTT

Paste this into a BLAST search page for me
GCTATCAGCGAGAGATACCCACCTTTCGCATTTATCCACGGGTGCGGCCAACGAGCTCGGGATCCAACAGTTCGAGAGGACCAACCTCAATGGCAAGGCGCAACGACGGGAGTGCCAAGGGATCAGTTTATGGGAATGCCGCTGTTCACCAGCCGCCAATTTGCTGATGTCCGATGAGCTGAGAGCTGAACCCTGGTCAAGGGAGAGCAGCCATCAAGCATAGAAATTACTAAGCAAGCAGCCGAGGCTGCGGATTCTTACCATGACACCCCAAGATCCTTCATCAGCAGTGCGTAGCTTTTAAGCGTTCTTATGTTCGTGTGTTTCGTGTGTTTATATGTGCCCAACTT

Full Affymetrix probeset data:

Annotations for 1625480_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime