FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625483_at:

>probe:Drosophila_2:1625483_at:322:57; Interrogation_Position=338; Antisense; ATGAGCAGGACTTCGTTGAACCAGC
>probe:Drosophila_2:1625483_at:129:381; Interrogation_Position=355; Antisense; GAACCAGCTGGCTCTCAGCAGGTAT
>probe:Drosophila_2:1625483_at:382:77; Interrogation_Position=374; Antisense; AGGTATCCGCCTCCTTGAACAAGGC
>probe:Drosophila_2:1625483_at:130:387; Interrogation_Position=390; Antisense; GAACAAGGCCCTGCGTGTGATCTTC
>probe:Drosophila_2:1625483_at:99:109; Interrogation_Position=443; Antisense; AGAACGCTGCTGTGGCTCTGGCCAA
>probe:Drosophila_2:1625483_at:458:23; Interrogation_Position=518; Antisense; ATATCGGAGATCTGAGCAACAAGCT
>probe:Drosophila_2:1625483_at:528:111; Interrogation_Position=532; Antisense; AGCAACAAGCTGAACTCTATCCGCA
>probe:Drosophila_2:1625483_at:610:509; Interrogation_Position=589; Antisense; GTGAAATACCGCACCAACCAGGATG
>probe:Drosophila_2:1625483_at:606:77; Interrogation_Position=660; Antisense; AGGATCCTCCACCATTCTGAACGGA
>probe:Drosophila_2:1625483_at:640:611; Interrogation_Position=677; Antisense; TGAACGGAGGTGTGGCTCCCGTCCT
>probe:Drosophila_2:1625483_at:13:505; Interrogation_Position=778; Antisense; GTCCTCCGTTTTCGCCAATAAGCAG
>probe:Drosophila_2:1625483_at:277:85; Interrogation_Position=801; Antisense; AGTGACTGACCTCAGACTGACCCAT
>probe:Drosophila_2:1625483_at:695:55; Interrogation_Position=824; Antisense; ATGACCCATCAACGATTCCTACGCA
>probe:Drosophila_2:1625483_at:465:323; Interrogation_Position=855; Antisense; GCGACCCACTTTGCTTAGTTTGTAA

Paste this into a BLAST search page for me
ATGAGCAGGACTTCGTTGAACCAGCGAACCAGCTGGCTCTCAGCAGGTATAGGTATCCGCCTCCTTGAACAAGGCGAACAAGGCCCTGCGTGTGATCTTCAGAACGCTGCTGTGGCTCTGGCCAAATATCGGAGATCTGAGCAACAAGCTAGCAACAAGCTGAACTCTATCCGCAGTGAAATACCGCACCAACCAGGATGAGGATCCTCCACCATTCTGAACGGATGAACGGAGGTGTGGCTCCCGTCCTGTCCTCCGTTTTCGCCAATAAGCAGAGTGACTGACCTCAGACTGACCCATATGACCCATCAACGATTCCTACGCAGCGACCCACTTTGCTTAGTTTGTAA

Full Affymetrix probeset data:

Annotations for 1625483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720