FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625487_at:

>probe:Drosophila_2:1625487_at:177:453; Interrogation_Position=1171; Antisense; GATCAGGTGACCTACATCAACTGGA
>probe:Drosophila_2:1625487_at:121:213; Interrogation_Position=1195; Antisense; AAGACTACAGACATCAAGGCCGGTT
>probe:Drosophila_2:1625487_at:123:223; Interrogation_Position=1210; Antisense; AAGGCCGGTTGGTCCTATGCTTGCG
>probe:Drosophila_2:1625487_at:615:517; Interrogation_Position=1237; Antisense; GTGGCCGATTTCCTGAAGACCGTGA
>probe:Drosophila_2:1625487_at:525:545; Interrogation_Position=1288; Antisense; GGAGGTCTCCTCGTTTAAATGGTGA
>probe:Drosophila_2:1625487_at:553:675; Interrogation_Position=747; Antisense; TAGCAGCAATGTCTACCTGGCACGT
>probe:Drosophila_2:1625487_at:433:531; Interrogation_Position=780; Antisense; GGGTGCCAAGGCTGATTTCGACTAC
>probe:Drosophila_2:1625487_at:510:265; Interrogation_Position=814; Antisense; CAGAGGGCAACCTTCCTGTTTATTA
>probe:Drosophila_2:1625487_at:659:647; Interrogation_Position=863; Antisense; TCAATGCCGGAAACTGGGCTCGTGT
>probe:Drosophila_2:1625487_at:294:607; Interrogation_Position=899; Antisense; TGAGGGCCTGGGTCTCCAAGAACAA
>probe:Drosophila_2:1625487_at:584:333; Interrogation_Position=924; Antisense; GCTGAACGTGAACTGCTATACCGGT
>probe:Drosophila_2:1625487_at:246:687; Interrogation_Position=940; Antisense; TATACCGGTGTCTACGGCGTGACCA
>probe:Drosophila_2:1625487_at:266:131; Interrogation_Position=964; Antisense; ACTCTGCCCAACAAGGACGGTGTGG
>probe:Drosophila_2:1625487_at:191:105; Interrogation_Position=989; Antisense; AGACGCCGCTTTATCTGGCCAAGGA

Paste this into a BLAST search page for me
GATCAGGTGACCTACATCAACTGGAAAGACTACAGACATCAAGGCCGGTTAAGGCCGGTTGGTCCTATGCTTGCGGTGGCCGATTTCCTGAAGACCGTGAGGAGGTCTCCTCGTTTAAATGGTGATAGCAGCAATGTCTACCTGGCACGTGGGTGCCAAGGCTGATTTCGACTACCAGAGGGCAACCTTCCTGTTTATTATCAATGCCGGAAACTGGGCTCGTGTTGAGGGCCTGGGTCTCCAAGAACAAGCTGAACGTGAACTGCTATACCGGTTATACCGGTGTCTACGGCGTGACCAACTCTGCCCAACAAGGACGGTGTGGAGACGCCGCTTTATCTGGCCAAGGA

Full Affymetrix probeset data:

Annotations for 1625487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720