FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625489_at:

>probe:Drosophila_2:1625489_at:533:207; Interrogation_Position=3101; Antisense; AAGCTCATGGATACGCAGCGGCAGC
>probe:Drosophila_2:1625489_at:289:121; Interrogation_Position=3117; Antisense; AGCGGCAGCTGGAAGCATGCGTCAA
>probe:Drosophila_2:1625489_at:584:229; Interrogation_Position=3214; Antisense; AATGTCGCAGGAGGAGCAGAACGCC
>probe:Drosophila_2:1625489_at:642:413; Interrogation_Position=3247; Antisense; GACCATCATGGATTTGCAACAAGCC
>probe:Drosophila_2:1625489_at:46:205; Interrogation_Position=3267; Antisense; AAGCCTTAAAGATCGCTCAAGCCAA
>probe:Drosophila_2:1625489_at:550:587; Interrogation_Position=3334; Antisense; TGGACCAGCTGGCTTCTTGAAGAGC
>probe:Drosophila_2:1625489_at:614:699; Interrogation_Position=3359; Antisense; TTTTTCTAAACAGTGCCCTCGCAAA
>probe:Drosophila_2:1625489_at:81:457; Interrogation_Position=3390; Antisense; GATACACACATCTTGGGATGCAGAT
>probe:Drosophila_2:1625489_at:612:145; Interrogation_Position=3431; Antisense; ACACGTACTACTTACCCAAAGCGAT
>probe:Drosophila_2:1625489_at:266:173; Interrogation_Position=3489; Antisense; AAAGCACTGTCTACTATTTTGTATA
>probe:Drosophila_2:1625489_at:33:17; Interrogation_Position=3504; Antisense; ATTTTGTATACTACCGATGCCGATA
>probe:Drosophila_2:1625489_at:647:53; Interrogation_Position=3541; Antisense; ATGCAGTATTTCTACGACTCTCACA
>probe:Drosophila_2:1625489_at:240:403; Interrogation_Position=3556; Antisense; GACTCTCACACACACTATGTACACT
>probe:Drosophila_2:1625489_at:319:61; Interrogation_Position=3572; Antisense; ATGTACACTCTTTACACACACAGAT

Paste this into a BLAST search page for me
AAGCTCATGGATACGCAGCGGCAGCAGCGGCAGCTGGAAGCATGCGTCAAAATGTCGCAGGAGGAGCAGAACGCCGACCATCATGGATTTGCAACAAGCCAAGCCTTAAAGATCGCTCAAGCCAATGGACCAGCTGGCTTCTTGAAGAGCTTTTTCTAAACAGTGCCCTCGCAAAGATACACACATCTTGGGATGCAGATACACGTACTACTTACCCAAAGCGATAAAGCACTGTCTACTATTTTGTATAATTTTGTATACTACCGATGCCGATAATGCAGTATTTCTACGACTCTCACAGACTCTCACACACACTATGTACACTATGTACACTCTTTACACACACAGAT

Full Affymetrix probeset data:

Annotations for 1625489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720