FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625490_at:

>probe:Drosophila_2:1625490_at:361:591; Interrogation_Position=364; Antisense; TGGTCTCTATTATCTGGCGGAGCTG
>probe:Drosophila_2:1625490_at:17:565; Interrogation_Position=414; Antisense; GGAAGTGCATCCTATTTCTGATCAG
>probe:Drosophila_2:1625490_at:526:605; Interrogation_Position=432; Antisense; TGATCAGCTTCACGATCTTCGTCTA
>probe:Drosophila_2:1625490_at:373:415; Interrogation_Position=490; Antisense; GAGCCTTATCATCTGCGGACTGGTG
>probe:Drosophila_2:1625490_at:598:285; Interrogation_Position=530; Antisense; CTGGGCATCATGAGTGGATTCCCCT
>probe:Drosophila_2:1625490_at:159:53; Interrogation_Position=596; Antisense; ATGCTGGTGGTCAATCACTTCCTGG
>probe:Drosophila_2:1625490_at:604:115; Interrogation_Position=627; Antisense; AGCATTTCGTCACTGTCTATGTGCC
>probe:Drosophila_2:1625490_at:595:79; Interrogation_Position=660; Antisense; AGGTGCTGGCTTACTTTACCATCTG
>probe:Drosophila_2:1625490_at:620:707; Interrogation_Position=675; Antisense; TTACCATCTGCATGTGGATCGTGCC
>probe:Drosophila_2:1625490_at:145:87; Interrogation_Position=722; Antisense; AGTGCGAATGACAGTGTCCTGCCCA
>probe:Drosophila_2:1625490_at:324:85; Interrogation_Position=773; Antisense; AGTCCGGACGTGGTCAGCAACTACT
>probe:Drosophila_2:1625490_at:292:111; Interrogation_Position=788; Antisense; AGCAACTACTTCTCGCGTAACAAGA
>probe:Drosophila_2:1625490_at:68:335; Interrogation_Position=823; Antisense; GCTGTCGCTGTTCCAGTATCTGAAA
>probe:Drosophila_2:1625490_at:172:371; Interrogation_Position=874; Antisense; GAAGGCCTTCTAGATCTAGCTTGTT

Paste this into a BLAST search page for me
TGGTCTCTATTATCTGGCGGAGCTGGGAAGTGCATCCTATTTCTGATCAGTGATCAGCTTCACGATCTTCGTCTAGAGCCTTATCATCTGCGGACTGGTGCTGGGCATCATGAGTGGATTCCCCTATGCTGGTGGTCAATCACTTCCTGGAGCATTTCGTCACTGTCTATGTGCCAGGTGCTGGCTTACTTTACCATCTGTTACCATCTGCATGTGGATCGTGCCAGTGCGAATGACAGTGTCCTGCCCAAGTCCGGACGTGGTCAGCAACTACTAGCAACTACTTCTCGCGTAACAAGAGCTGTCGCTGTTCCAGTATCTGAAAGAAGGCCTTCTAGATCTAGCTTGTT

Full Affymetrix probeset data:

Annotations for 1625490_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720