Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625491_at:

>probe:Drosophila_2:1625491_at:717:589; Interrogation_Position=1728; Antisense; TGGTTCCTACGCTTTCCCAAAGAGA
>probe:Drosophila_2:1625491_at:695:669; Interrogation_Position=1803; Antisense; TACGCAAACTAACCAACTAACACCT
>probe:Drosophila_2:1625491_at:573:187; Interrogation_Position=1821; Antisense; AACACCTACACTTATTCTGGATTGG
>probe:Drosophila_2:1625491_at:77:53; Interrogation_Position=1917; Antisense; ATGCAATCCAAATCATTCAACCCGC
>probe:Drosophila_2:1625491_at:486:673; Interrogation_Position=1942; Antisense; TACCTTGCTGATTCCACAGATTCGA
>probe:Drosophila_2:1625491_at:297:393; Interrogation_Position=1965; Antisense; GAAAGATTGGCTCGTCTACTGCAGT
>probe:Drosophila_2:1625491_at:379:337; Interrogation_Position=1974; Antisense; GCTCGTCTACTGCAGTCTGTACATG
>probe:Drosophila_2:1625491_at:287:641; Interrogation_Position=1989; Antisense; TCTGTACATGCAGGACTATGACTAT
>probe:Drosophila_2:1625491_at:191:211; Interrogation_Position=2041; Antisense; AAGAAATCGGGTGGAGAGCCTTCTC
>probe:Drosophila_2:1625491_at:518:425; Interrogation_Position=2054; Antisense; GAGAGCCTTCTCCAAACAGAGACAT
>probe:Drosophila_2:1625491_at:569:703; Interrogation_Position=2129; Antisense; TTATTAACTACAAAGCTCGCCTGCT
>probe:Drosophila_2:1625491_at:199:285; Interrogation_Position=2149; Antisense; CTGCTCATCGCGGAAACCAAATTAT
>probe:Drosophila_2:1625491_at:558:143; Interrogation_Position=2249; Antisense; ACTGTGTTAGGAATGCAAGCTCTCT
>probe:Drosophila_2:1625491_at:468:359; Interrogation_Position=2263; Antisense; GCAAGCTCTCTTGTTTAATCGCAAT

Paste this into a BLAST search page for me
TGGTTCCTACGCTTTCCCAAAGAGATACGCAAACTAACCAACTAACACCTAACACCTACACTTATTCTGGATTGGATGCAATCCAAATCATTCAACCCGCTACCTTGCTGATTCCACAGATTCGAGAAAGATTGGCTCGTCTACTGCAGTGCTCGTCTACTGCAGTCTGTACATGTCTGTACATGCAGGACTATGACTATAAGAAATCGGGTGGAGAGCCTTCTCGAGAGCCTTCTCCAAACAGAGACATTTATTAACTACAAAGCTCGCCTGCTCTGCTCATCGCGGAAACCAAATTATACTGTGTTAGGAATGCAAGCTCTCTGCAAGCTCTCTTGTTTAATCGCAAT

Full Affymetrix probeset data:

Annotations for 1625491_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime