FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625493_at:

>probe:Drosophila_2:1625493_at:335:227; Interrogation_Position=137; Antisense; AATGGCCACCAAATACGAGATGTCG
>probe:Drosophila_2:1625493_at:485:39; Interrogation_Position=250; Antisense; ATCTGATGGCCGAGTGCGTTGCTCA
>probe:Drosophila_2:1625493_at:383:293; Interrogation_Position=266; Antisense; CGTTGCTCAGACTGGCGATGCCAAA
>probe:Drosophila_2:1625493_at:58:401; Interrogation_Position=303; Antisense; GACATCCTGGAAGTCACCGTGCAGC
>probe:Drosophila_2:1625493_at:286:499; Interrogation_Position=347; Antisense; GTCTAAGAAGCATGTTCCGGCCAAT
>probe:Drosophila_2:1625493_at:542:235; Interrogation_Position=369; Antisense; AATCCCGAACAGAGTTTCCGTGCTG
>probe:Drosophila_2:1625493_at:706:301; Interrogation_Position=441; Antisense; CCCCGAGTGGATGTGGCTTTTGGAA
>probe:Drosophila_2:1625493_at:146:691; Interrogation_Position=459; Antisense; TTTGGAACCACACTGATGACCCATC
>probe:Drosophila_2:1625493_at:625:593; Interrogation_Position=484; Antisense; TGGGCATGCGTCTCAACCAACTGGA
>probe:Drosophila_2:1625493_at:402:553; Interrogation_Position=506; Antisense; GGAGCAGCCCATGGAACAACCGCAA
>probe:Drosophila_2:1625493_at:432:91; Interrogation_Position=549; Antisense; AGTATCGTCTGTGGATCCAGCTCTA
>probe:Drosophila_2:1625493_at:689:33; Interrogation_Position=612; Antisense; ATCAGTCCCGTTTCCAGTGGATATG
>probe:Drosophila_2:1625493_at:573:457; Interrogation_Position=631; Antisense; GATATGCCAGCGACAACGAGTCTCT
>probe:Drosophila_2:1625493_at:581:515; Interrogation_Position=681; Antisense; GTGTGGCGTCCCTGGTAAACAAAGA

Paste this into a BLAST search page for me
AATGGCCACCAAATACGAGATGTCGATCTGATGGCCGAGTGCGTTGCTCACGTTGCTCAGACTGGCGATGCCAAAGACATCCTGGAAGTCACCGTGCAGCGTCTAAGAAGCATGTTCCGGCCAATAATCCCGAACAGAGTTTCCGTGCTGCCCCGAGTGGATGTGGCTTTTGGAATTTGGAACCACACTGATGACCCATCTGGGCATGCGTCTCAACCAACTGGAGGAGCAGCCCATGGAACAACCGCAAAGTATCGTCTGTGGATCCAGCTCTAATCAGTCCCGTTTCCAGTGGATATGGATATGCCAGCGACAACGAGTCTCTGTGTGGCGTCCCTGGTAAACAAAGA

Full Affymetrix probeset data:

Annotations for 1625493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720