FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625494_at:

>probe:Drosophila_2:1625494_at:351:495; Interrogation_Position=1823; Antisense; GTCACATCTACCACAATCACGAGTG
>probe:Drosophila_2:1625494_at:204:617; Interrogation_Position=1864; Antisense; TGCACCATGTGCGAAAAGGCTTTCA
>probe:Drosophila_2:1625494_at:19:169; Interrogation_Position=1878; Antisense; AAAGGCTTTCAAGCGGCCGCAGGAA
>probe:Drosophila_2:1625494_at:49:207; Interrogation_Position=1888; Antisense; AAGCGGCCGCAGGAACTCAAGGAAC
>probe:Drosophila_2:1625494_at:631:157; Interrogation_Position=1911; Antisense; ACACACATCCACTCATACGGGTGAA
>probe:Drosophila_2:1625494_at:613:509; Interrogation_Position=1931; Antisense; GTGAAGTACTCTACACCTGTCCCAA
>probe:Drosophila_2:1625494_at:538:193; Interrogation_Position=1954; Antisense; AACTGCCCGATGACATTCTTCTGCT
>probe:Drosophila_2:1625494_at:417:153; Interrogation_Position=1985; Antisense; ACATGTACAAGCATCGCCAGCGATT
>probe:Drosophila_2:1625494_at:559:151; Interrogation_Position=2057; Antisense; ACATCCTGAAGATTTCGCGCAACGC
>probe:Drosophila_2:1625494_at:539:19; Interrogation_Position=2138; Antisense; ATATTCGAACGCCTTTCTTCACTTT
>probe:Drosophila_2:1625494_at:89:55; Interrogation_Position=2210; Antisense; ATGACACATTCGCACAACAGTTTTT
>probe:Drosophila_2:1625494_at:308:327; Interrogation_Position=2321; Antisense; GCGTTTTGTACCTTAGTCCTAAGCT
>probe:Drosophila_2:1625494_at:253:655; Interrogation_Position=2358; Antisense; TAATAAATGCGAACTGGACTCTGCT
>probe:Drosophila_2:1625494_at:345:405; Interrogation_Position=2374; Antisense; GACTCTGCTCCGATCCAAATAATTG

Paste this into a BLAST search page for me
GTCACATCTACCACAATCACGAGTGTGCACCATGTGCGAAAAGGCTTTCAAAAGGCTTTCAAGCGGCCGCAGGAAAAGCGGCCGCAGGAACTCAAGGAACACACACATCCACTCATACGGGTGAAGTGAAGTACTCTACACCTGTCCCAAAACTGCCCGATGACATTCTTCTGCTACATGTACAAGCATCGCCAGCGATTACATCCTGAAGATTTCGCGCAACGCATATTCGAACGCCTTTCTTCACTTTATGACACATTCGCACAACAGTTTTTGCGTTTTGTACCTTAGTCCTAAGCTTAATAAATGCGAACTGGACTCTGCTGACTCTGCTCCGATCCAAATAATTG

Full Affymetrix probeset data:

Annotations for 1625494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720