FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625495_at:

>probe:Drosophila_2:1625495_at:588:15; Interrogation_Position=1081; Antisense; ATTATAGCGCCATCCGTGCAACCAG
>probe:Drosophila_2:1625495_at:601:177; Interrogation_Position=1107; Antisense; AAACATATCGGTGACTCGCAAGACG
>probe:Drosophila_2:1625495_at:211:455; Interrogation_Position=1142; Antisense; GATACAAGCGTCATGCGATACCAGC
>probe:Drosophila_2:1625495_at:215:589; Interrogation_Position=1178; Antisense; TGGATGCAAATCTCTTTCTGACCCT
>probe:Drosophila_2:1625495_at:445:461; Interrogation_Position=1285; Antisense; GATTTTGAGCCACACTATATCGGAG
>probe:Drosophila_2:1625495_at:6:573; Interrogation_Position=1311; Antisense; GGCGGCCGAGGGAAAGTCCAACTAT
>probe:Drosophila_2:1625495_at:215:453; Interrogation_Position=1347; Antisense; GATCAGCCACGTATTCTACTTGGGC
>probe:Drosophila_2:1625495_at:92:535; Interrogation_Position=1383; Antisense; GGTGCACACCACCTTCAAGGTATAT
>probe:Drosophila_2:1625495_at:12:587; Interrogation_Position=1469; Antisense; TGGACACACCGGAGTACAACCTAAT
>probe:Drosophila_2:1625495_at:222:203; Interrogation_Position=1486; Antisense; AACCTAATGATCCTGTTGCCCGACT
>probe:Drosophila_2:1625495_at:715:403; Interrogation_Position=1507; Antisense; GACTACCACACGGATATTGTTGCAG
>probe:Drosophila_2:1625495_at:296:415; Interrogation_Position=1553; Antisense; GACCAACCCTTCGACTGATGCGGAA
>probe:Drosophila_2:1625495_at:456:531; Interrogation_Position=1595; Antisense; GGGTGCAAGCCATCATTCCAGATTT
>probe:Drosophila_2:1625495_at:297:617; Interrogation_Position=1625; Antisense; TGCACGGCACCATGTTTTTGACAAA

Paste this into a BLAST search page for me
ATTATAGCGCCATCCGTGCAACCAGAAACATATCGGTGACTCGCAAGACGGATACAAGCGTCATGCGATACCAGCTGGATGCAAATCTCTTTCTGACCCTGATTTTGAGCCACACTATATCGGAGGGCGGCCGAGGGAAAGTCCAACTATGATCAGCCACGTATTCTACTTGGGCGGTGCACACCACCTTCAAGGTATATTGGACACACCGGAGTACAACCTAATAACCTAATGATCCTGTTGCCCGACTGACTACCACACGGATATTGTTGCAGGACCAACCCTTCGACTGATGCGGAAGGGTGCAAGCCATCATTCCAGATTTTGCACGGCACCATGTTTTTGACAAA

Full Affymetrix probeset data:

Annotations for 1625495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720