FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625496_at:

>probe:Drosophila_2:1625496_at:407:21; Interrogation_Position=2977; Antisense; ATATTCCAGCAATTCAGCCAGTTCT
>probe:Drosophila_2:1625496_at:316:675; Interrogation_Position=3011; Antisense; TAGCCATGCAGACGTACCACTTTGA
>probe:Drosophila_2:1625496_at:4:439; Interrogation_Position=3043; Antisense; GAGGCTGAGGTAGCAATACTCCGTA
>probe:Drosophila_2:1625496_at:244:359; Interrogation_Position=3074; Antisense; GCAAGGCCGACTTTGTAGACTACTT
>probe:Drosophila_2:1625496_at:306:213; Interrogation_Position=3125; Antisense; AAGAGCGACGCGTTCTGTCCGTACA
>probe:Drosophila_2:1625496_at:467:489; Interrogation_Position=3145; Antisense; GTACACATTGTATCCCAGCAAACCG
>probe:Drosophila_2:1625496_at:81:167; Interrogation_Position=3174; Antisense; AAATGCCACGTCAGAAGCGGAGCCC
>probe:Drosophila_2:1625496_at:485:205; Interrogation_Position=3188; Antisense; AAGCGGAGCCCGTGGAGATCACAAA
>probe:Drosophila_2:1625496_at:113:555; Interrogation_Position=3216; Antisense; GGAGCGCCACAAACCAATCAGCGAT
>probe:Drosophila_2:1625496_at:611:215; Interrogation_Position=3253; Antisense; AAGTCGTGCAAGGAGCTTTACCCCA
>probe:Drosophila_2:1625496_at:636:619; Interrogation_Position=3279; Antisense; TGCTCTGCCATTCCTTGACATTAAG
>probe:Drosophila_2:1625496_at:316:529; Interrogation_Position=3309; Antisense; GGGAGCACGCAGCAAGCTTTAAACT
>probe:Drosophila_2:1625496_at:424:435; Interrogation_Position=3348; Antisense; GAGGTCTTTCTTAATAGCACATGGT
>probe:Drosophila_2:1625496_at:498:111; Interrogation_Position=3363; Antisense; AGCACATGGTTTTGGTCTCTTTTTG

Paste this into a BLAST search page for me
ATATTCCAGCAATTCAGCCAGTTCTTAGCCATGCAGACGTACCACTTTGAGAGGCTGAGGTAGCAATACTCCGTAGCAAGGCCGACTTTGTAGACTACTTAAGAGCGACGCGTTCTGTCCGTACAGTACACATTGTATCCCAGCAAACCGAAATGCCACGTCAGAAGCGGAGCCCAAGCGGAGCCCGTGGAGATCACAAAGGAGCGCCACAAACCAATCAGCGATAAGTCGTGCAAGGAGCTTTACCCCATGCTCTGCCATTCCTTGACATTAAGGGGAGCACGCAGCAAGCTTTAAACTGAGGTCTTTCTTAATAGCACATGGTAGCACATGGTTTTGGTCTCTTTTTG

Full Affymetrix probeset data:

Annotations for 1625496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720