FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625498_at:

>probe:Drosophila_2:1625498_at:214:453; Interrogation_Position=16; Antisense; GATCACAAGGTTTTCATTTTCGCCG
>probe:Drosophila_2:1625498_at:110:687; Interrogation_Position=160; Antisense; TATTCTCGAGCCAAGACCAGCTTGA
>probe:Drosophila_2:1625498_at:693:167; Interrogation_Position=189; Antisense; AAATGTCACGTTCGTGGAGCCGGCC
>probe:Drosophila_2:1625498_at:462:553; Interrogation_Position=204; Antisense; GGAGCCGGCCAGAAATATATCAGTT
>probe:Drosophila_2:1625498_at:203:15; Interrogation_Position=31; Antisense; ATTTTCGCCGTTTCGCTATTAGTGG
>probe:Drosophila_2:1625498_at:514:39; Interrogation_Position=337; Antisense; ATCTGGTACATGATCCGGAACGTGT
>probe:Drosophila_2:1625498_at:679:301; Interrogation_Position=382; Antisense; CCCTATGAGGGCTTGCAGATGCTGA
>probe:Drosophila_2:1625498_at:116:99; Interrogation_Position=398; Antisense; AGATGCTGAGCGACTTTCACAAAGT
>probe:Drosophila_2:1625498_at:381:159; Interrogation_Position=416; Antisense; ACAAAGTCGACATTCCTGTGCCACT
>probe:Drosophila_2:1625498_at:55:645; Interrogation_Position=456; Antisense; TCTACTAATGGTCGACTGGTTGTTC
>probe:Drosophila_2:1625498_at:158:565; Interrogation_Position=484; Antisense; GGCAAAACGCAGTTCGCCACGAATG
>probe:Drosophila_2:1625498_at:230:679; Interrogation_Position=50; Antisense; TAGTGGCCTATCTAAGCTGCGGAGA
>probe:Drosophila_2:1625498_at:580:25; Interrogation_Position=523; Antisense; ATAGAGGACTTACTGCCGACGAGCT
>probe:Drosophila_2:1625498_at:176:327; Interrogation_Position=563; Antisense; GCAGTAAGGAGTTCCCCGTCTTACG

Paste this into a BLAST search page for me
GATCACAAGGTTTTCATTTTCGCCGTATTCTCGAGCCAAGACCAGCTTGAAAATGTCACGTTCGTGGAGCCGGCCGGAGCCGGCCAGAAATATATCAGTTATTTTCGCCGTTTCGCTATTAGTGGATCTGGTACATGATCCGGAACGTGTCCCTATGAGGGCTTGCAGATGCTGAAGATGCTGAGCGACTTTCACAAAGTACAAAGTCGACATTCCTGTGCCACTTCTACTAATGGTCGACTGGTTGTTCGGCAAAACGCAGTTCGCCACGAATGTAGTGGCCTATCTAAGCTGCGGAGAATAGAGGACTTACTGCCGACGAGCTGCAGTAAGGAGTTCCCCGTCTTACG

Full Affymetrix probeset data:

Annotations for 1625498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720