FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625499_at:

>probe:Drosophila_2:1625499_at:578:427; Interrogation_Position=1025; Antisense; GAGATCGGATCTAGGCTGCAGCAAA
>probe:Drosophila_2:1625499_at:75:15; Interrogation_Position=1085; Antisense; ATTACGGATGCGGTGTGTCCTGTTC
>probe:Drosophila_2:1625499_at:671:497; Interrogation_Position=1112; Antisense; GTCTTCCAGGATAACGATCGCGTTC
>probe:Drosophila_2:1625499_at:494:349; Interrogation_Position=1162; Antisense; GCAGGGCGAGATTTTCGACACCAAT
>probe:Drosophila_2:1625499_at:651:397; Interrogation_Position=1178; Antisense; GACACCAATGGTTGTGGCGACGCCT
>probe:Drosophila_2:1625499_at:89:543; Interrogation_Position=1211; Antisense; GGATTCCTGGCCATGTACGTCCAAA
>probe:Drosophila_2:1625499_at:352:169; Interrogation_Position=1233; Antisense; AAAGGATGCCCCTGGATTACTGCAT
>probe:Drosophila_2:1625499_at:140:79; Interrogation_Position=1284; Antisense; AGGTCCTACACGTGGTCGGTGTTCA
>probe:Drosophila_2:1625499_at:278:409; Interrogation_Position=1391; Antisense; GACGAGTACCATTAGGACCTTAAAT
>probe:Drosophila_2:1625499_at:493:339; Interrogation_Position=845; Antisense; GCTAGGATGTGCTGCGAGACCAATC
>probe:Drosophila_2:1625499_at:175:245; Interrogation_Position=871; Antisense; AATTATGATCCTCAACTTCAGCGCC
>probe:Drosophila_2:1625499_at:713:299; Interrogation_Position=892; Antisense; CGCCGTGTTTGTGCTGCAGATGCAA
>probe:Drosophila_2:1625499_at:272:379; Interrogation_Position=920; Antisense; GAAGCCTTGGGCAATATCCTGCAGT
>probe:Drosophila_2:1625499_at:60:441; Interrogation_Position=974; Antisense; GAGGCCATTGCATTTAGCGACACCA

Paste this into a BLAST search page for me
GAGATCGGATCTAGGCTGCAGCAAAATTACGGATGCGGTGTGTCCTGTTCGTCTTCCAGGATAACGATCGCGTTCGCAGGGCGAGATTTTCGACACCAATGACACCAATGGTTGTGGCGACGCCTGGATTCCTGGCCATGTACGTCCAAAAAAGGATGCCCCTGGATTACTGCATAGGTCCTACACGTGGTCGGTGTTCAGACGAGTACCATTAGGACCTTAAATGCTAGGATGTGCTGCGAGACCAATCAATTATGATCCTCAACTTCAGCGCCCGCCGTGTTTGTGCTGCAGATGCAAGAAGCCTTGGGCAATATCCTGCAGTGAGGCCATTGCATTTAGCGACACCA

Full Affymetrix probeset data:

Annotations for 1625499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720