Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625500_at:

>probe:Drosophila_2:1625500_at:139:239; Interrogation_Position=1760; Antisense; AATCACAATAAGTCCGCCATTGCCT
>probe:Drosophila_2:1625500_at:107:275; Interrogation_Position=1777; Antisense; CATTGCCTCTCAAGGAGCTGCTAAT
>probe:Drosophila_2:1625500_at:291:419; Interrogation_Position=1791; Antisense; GAGCTGCTAATCTTGTCGCTGGAAA
>probe:Drosophila_2:1625500_at:99:535; Interrogation_Position=1869; Antisense; GGTGCTGCGGACATTCTTCTGAAAA
>probe:Drosophila_2:1625500_at:474:169; Interrogation_Position=1892; Antisense; AAAGGCGCCCATCATGAGAGAGTAT
>probe:Drosophila_2:1625500_at:477:91; Interrogation_Position=1912; Antisense; AGTATTTCGGGCTGCGCATCTCGGA
>probe:Drosophila_2:1625500_at:265:547; Interrogation_Position=1937; Antisense; GGATGGAATGCTCGAATCTCTGCCC
>probe:Drosophila_2:1625500_at:382:397; Interrogation_Position=2048; Antisense; GACACGATGCTTCGAGACATTCTGT
>probe:Drosophila_2:1625500_at:267:391; Interrogation_Position=2076; Antisense; GAAACTGCTCGATTTTACGCGCAAT
>probe:Drosophila_2:1625500_at:201:145; Interrogation_Position=2121; Antisense; ACTGCGGGCTTTTCCAGATGGACAA
>probe:Drosophila_2:1625500_at:230:545; Interrogation_Position=2204; Antisense; GGATCAGATCTACGAGCTCACTAAC
>probe:Drosophila_2:1625500_at:467:659; Interrogation_Position=2225; Antisense; TAACCTGCCCACTCTGTACAAGGTG
>probe:Drosophila_2:1625500_at:376:665; Interrogation_Position=2241; Antisense; TACAAGGTGTTCGAGCGGTGCTAGT
>probe:Drosophila_2:1625500_at:653:339; Interrogation_Position=2260; Antisense; GCTAGTTTAGGTTGTTCACTTCCAG

Paste this into a BLAST search page for me
AATCACAATAAGTCCGCCATTGCCTCATTGCCTCTCAAGGAGCTGCTAATGAGCTGCTAATCTTGTCGCTGGAAAGGTGCTGCGGACATTCTTCTGAAAAAAAGGCGCCCATCATGAGAGAGTATAGTATTTCGGGCTGCGCATCTCGGAGGATGGAATGCTCGAATCTCTGCCCGACACGATGCTTCGAGACATTCTGTGAAACTGCTCGATTTTACGCGCAATACTGCGGGCTTTTCCAGATGGACAAGGATCAGATCTACGAGCTCACTAACTAACCTGCCCACTCTGTACAAGGTGTACAAGGTGTTCGAGCGGTGCTAGTGCTAGTTTAGGTTGTTCACTTCCAG

Full Affymetrix probeset data:

Annotations for 1625500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime