FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625502_at:

>probe:Drosophila_2:1625502_at:411:309; Interrogation_Position=102; Antisense; CCAGCAGTACTACGCCATATTCGAT
>probe:Drosophila_2:1625502_at:578:1; Interrogation_Position=30; Antisense; ATCGTACCCCGTATATACTTGAACT
>probe:Drosophila_2:1625502_at:369:345; Interrogation_Position=358; Antisense; GCATTCTCGCAGATCTTTTTGCTGA
>probe:Drosophila_2:1625502_at:543:635; Interrogation_Position=364; Antisense; TCGCAGATCTTTTTGCTGAAGCCCA
>probe:Drosophila_2:1625502_at:537:197; Interrogation_Position=388; Antisense; AACGGAGGATCCCTCTTCGTGGCTC
>probe:Drosophila_2:1625502_at:509:679; Interrogation_Position=448; Antisense; TAGGAGCACTCCAGACCCATATGTA
>probe:Drosophila_2:1625502_at:375:265; Interrogation_Position=459; Antisense; CAGACCCATATGTACACCACACATA
>probe:Drosophila_2:1625502_at:462:411; Interrogation_Position=497; Antisense; GACGCCCAGCGCCTAATAGTGATAA
>probe:Drosophila_2:1625502_at:85:661; Interrogation_Position=519; Antisense; TAACATGATAACAACAGCACGGCAG
>probe:Drosophila_2:1625502_at:662:155; Interrogation_Position=532; Antisense; ACAGCACGGCAGTGGGACTCAGAAA
>probe:Drosophila_2:1625502_at:304:185; Interrogation_Position=55; Antisense; AAAATGTCTCTGAATCTGCAGTACG
>probe:Drosophila_2:1625502_at:365:175; Interrogation_Position=567; Antisense; AAAGCCAGCCAACGGTCTCAAGATC
>probe:Drosophila_2:1625502_at:365:197; Interrogation_Position=577; Antisense; AACGGTCTCAAGATCGTCAGCGAAT
>probe:Drosophila_2:1625502_at:723:363; Interrogation_Position=94; Antisense; GAATTTGTCCAGCAGTACTACGCCA

Paste this into a BLAST search page for me
CCAGCAGTACTACGCCATATTCGATATCGTACCCCGTATATACTTGAACTGCATTCTCGCAGATCTTTTTGCTGATCGCAGATCTTTTTGCTGAAGCCCAAACGGAGGATCCCTCTTCGTGGCTCTAGGAGCACTCCAGACCCATATGTACAGACCCATATGTACACCACACATAGACGCCCAGCGCCTAATAGTGATAATAACATGATAACAACAGCACGGCAGACAGCACGGCAGTGGGACTCAGAAAAAAATGTCTCTGAATCTGCAGTACGAAAGCCAGCCAACGGTCTCAAGATCAACGGTCTCAAGATCGTCAGCGAATGAATTTGTCCAGCAGTACTACGCCA

Full Affymetrix probeset data:

Annotations for 1625502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720