Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625503_at:

>probe:Drosophila_2:1625503_at:198:569; Interrogation_Position=1082; Antisense; GGCAGCAGGTGAATATATATGACTA
>probe:Drosophila_2:1625503_at:10:57; Interrogation_Position=1100; Antisense; ATGACTAATGTCGTGTGGTCGCCAA
>probe:Drosophila_2:1625503_at:342:519; Interrogation_Position=1114; Antisense; GTGGTCGCCAATCGCAAGAACCATT
>probe:Drosophila_2:1625503_at:680:247; Interrogation_Position=1128; Antisense; CAAGAACCATTGATTCTTGGGCCCC
>probe:Drosophila_2:1625503_at:347:237; Interrogation_Position=1155; Antisense; AATCGAATACATCTGATACTAGCTG
>probe:Drosophila_2:1625503_at:53:457; Interrogation_Position=1169; Antisense; GATACTAGCTGAACCACACGACTAC
>probe:Drosophila_2:1625503_at:559:665; Interrogation_Position=1191; Antisense; TACAGCCACAACAACTACCAATTCT
>probe:Drosophila_2:1625503_at:559:673; Interrogation_Position=1206; Antisense; TACCAATTCTACCACCAAGCAGAAC
>probe:Drosophila_2:1625503_at:401:163; Interrogation_Position=1245; Antisense; AAATACCAAATCTACACGAGCCGCC
>probe:Drosophila_2:1625503_at:156:307; Interrogation_Position=1286; Antisense; CCTCCTGCACTTACTCTATATGTTA
>probe:Drosophila_2:1625503_at:364:281; Interrogation_Position=1299; Antisense; CTCTATATGTTATTGATTGCCGTTA
>probe:Drosophila_2:1625503_at:558:725; Interrogation_Position=1311; Antisense; TTGATTGCCGTTATCCAAGTGCTGC
>probe:Drosophila_2:1625503_at:527:473; Interrogation_Position=1320; Antisense; GTTATCCAAGTGCTGCCCATCATTC
>probe:Drosophila_2:1625503_at:691:335; Interrogation_Position=1331; Antisense; GCTGCCCATCATTCTGTCAATAAAT

Paste this into a BLAST search page for me
GGCAGCAGGTGAATATATATGACTAATGACTAATGTCGTGTGGTCGCCAAGTGGTCGCCAATCGCAAGAACCATTCAAGAACCATTGATTCTTGGGCCCCAATCGAATACATCTGATACTAGCTGGATACTAGCTGAACCACACGACTACTACAGCCACAACAACTACCAATTCTTACCAATTCTACCACCAAGCAGAACAAATACCAAATCTACACGAGCCGCCCCTCCTGCACTTACTCTATATGTTACTCTATATGTTATTGATTGCCGTTATTGATTGCCGTTATCCAAGTGCTGCGTTATCCAAGTGCTGCCCATCATTCGCTGCCCATCATTCTGTCAATAAAT

Full Affymetrix probeset data:

Annotations for 1625503_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime