FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625505_at:

>probe:Drosophila_2:1625505_at:565:421; Interrogation_Position=111; Antisense; GAGCAAGCTCCTGGCGAAGGTACCG
>probe:Drosophila_2:1625505_at:392:371; Interrogation_Position=126; Antisense; GAAGGTACCGCATTTCCATCCAAAC
>probe:Drosophila_2:1625505_at:284:349; Interrogation_Position=153; Antisense; GCAGTTCTACGACGAGATGTCCGAA
>probe:Drosophila_2:1625505_at:381:11; Interrogation_Position=178; Antisense; ATTCTAAAGGATGACCCTGTCCCAC
>probe:Drosophila_2:1625505_at:442:349; Interrogation_Position=272; Antisense; GCAGGATGCTGTCTATGGGCACCAC
>probe:Drosophila_2:1625505_at:14:595; Interrogation_Position=287; Antisense; TGGGCACCACTGTCAGCACAGTTAT
>probe:Drosophila_2:1625505_at:335:703; Interrogation_Position=308; Antisense; TTATTCCCCGCCAAATGCGTACGTA
>probe:Drosophila_2:1625505_at:274:479; Interrogation_Position=423; Antisense; GTTTACAGTCTTTAATGCCGCCGAA
>probe:Drosophila_2:1625505_at:694:317; Interrogation_Position=439; Antisense; GCCGCCGAACCCAATACTAATGATT
>probe:Drosophila_2:1625505_at:395:459; Interrogation_Position=460; Antisense; GATTTGTCAGAGTCTGCGGCCGAGA
>probe:Drosophila_2:1625505_at:50:427; Interrogation_Position=481; Antisense; GAGATCTCCATCAGCAACGACGAAG
>probe:Drosophila_2:1625505_at:90:107; Interrogation_Position=514; Antisense; AGACACCTAAGAGCGCTCCAGGAGT
>probe:Drosophila_2:1625505_at:344:309; Interrogation_Position=531; Antisense; CCAGGAGTACGCCATGATCCATGAT
>probe:Drosophila_2:1625505_at:297:683; Interrogation_Position=604; Antisense; TATCCAGCCCAGATCAAGGACTTCG

Paste this into a BLAST search page for me
GAGCAAGCTCCTGGCGAAGGTACCGGAAGGTACCGCATTTCCATCCAAACGCAGTTCTACGACGAGATGTCCGAAATTCTAAAGGATGACCCTGTCCCACGCAGGATGCTGTCTATGGGCACCACTGGGCACCACTGTCAGCACAGTTATTTATTCCCCGCCAAATGCGTACGTAGTTTACAGTCTTTAATGCCGCCGAAGCCGCCGAACCCAATACTAATGATTGATTTGTCAGAGTCTGCGGCCGAGAGAGATCTCCATCAGCAACGACGAAGAGACACCTAAGAGCGCTCCAGGAGTCCAGGAGTACGCCATGATCCATGATTATCCAGCCCAGATCAAGGACTTCG

Full Affymetrix probeset data:

Annotations for 1625505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720