FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625508_at:

>probe:Drosophila_2:1625508_at:683:219; Interrogation_Position=104; Antisense; AAGTGCATCCGCAGGACTTTGGCAA
>probe:Drosophila_2:1625508_at:566:403; Interrogation_Position=118; Antisense; GACTTTGGCAACTACTCCTGTGTGG
>probe:Drosophila_2:1625508_at:268:193; Interrogation_Position=127; Antisense; AACTACTCCTGTGTGGCGGAAAATC
>probe:Drosophila_2:1625508_at:20:493; Interrogation_Position=13; Antisense; GTAATTTGGTTCAAAGACACCATGC
>probe:Drosophila_2:1625508_at:242:35; Interrogation_Position=149; Antisense; ATCAGCTGGGAAAGGCACGCAAGAC
>probe:Drosophila_2:1625508_at:404:355; Interrogation_Position=167; Antisense; GCAAGACCCTCCAGTTGAGCGGAAA
>probe:Drosophila_2:1625508_at:389:581; Interrogation_Position=200; Antisense; TGGCCGTTTTTAATTCACCGCCAAT
>probe:Drosophila_2:1625508_at:351:711; Interrogation_Position=213; Antisense; TTCACCGCCAATCAGTCAGTACAAG
>probe:Drosophila_2:1625508_at:378:399; Interrogation_Position=28; Antisense; GACACCATGCAATTGGATACCACGG
>probe:Drosophila_2:1625508_at:449:589; Interrogation_Position=41; Antisense; TGGATACCACGGAGCGGCACATCAT
>probe:Drosophila_2:1625508_at:344:141; Interrogation_Position=49; Antisense; ACGGAGCGGCACATCATGGAGACGC
>probe:Drosophila_2:1625508_at:545:529; Interrogation_Position=75; Antisense; GGGATCAAGGCACACGCTGATTATA
>probe:Drosophila_2:1625508_at:127:567; Interrogation_Position=83; Antisense; GGCACACGCTGATTATACGCAAAGT
>probe:Drosophila_2:1625508_at:99:673; Interrogation_Position=98; Antisense; TACGCAAAGTGCATCCGCAGGACTT

Paste this into a BLAST search page for me
AAGTGCATCCGCAGGACTTTGGCAAGACTTTGGCAACTACTCCTGTGTGGAACTACTCCTGTGTGGCGGAAAATCGTAATTTGGTTCAAAGACACCATGCATCAGCTGGGAAAGGCACGCAAGACGCAAGACCCTCCAGTTGAGCGGAAATGGCCGTTTTTAATTCACCGCCAATTTCACCGCCAATCAGTCAGTACAAGGACACCATGCAATTGGATACCACGGTGGATACCACGGAGCGGCACATCATACGGAGCGGCACATCATGGAGACGCGGGATCAAGGCACACGCTGATTATAGGCACACGCTGATTATACGCAAAGTTACGCAAAGTGCATCCGCAGGACTT

Full Affymetrix probeset data:

Annotations for 1625508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720