FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625510_at:

>probe:Drosophila_2:1625510_at:665:299; Interrogation_Position=360; Antisense; CGCCGATGAGGTGGTCGTGTTCAAC
>probe:Drosophila_2:1625510_at:473:409; Interrogation_Position=417; Antisense; GACGATGATTCTCAAGTTCCTGAAA
>probe:Drosophila_2:1625510_at:396:391; Interrogation_Position=464; Antisense; GAAACCACGGACTCCAACTGAGGCT
>probe:Drosophila_2:1625510_at:582:375; Interrogation_Position=549; Antisense; GAAGAAGTGGCTCATTATCCTGCCC
>probe:Drosophila_2:1625510_at:59:627; Interrogation_Position=569; Antisense; TGCCCCTCGTCATTCTGATGAAGAT
>probe:Drosophila_2:1625510_at:290:463; Interrogation_Position=591; Antisense; GATTGCCCACCTGAAGATGACTTTG
>probe:Drosophila_2:1625510_at:107:621; Interrogation_Position=635; Antisense; TGCTCGGCATGAACGTGCTGCTGGT
>probe:Drosophila_2:1625510_at:222:583; Interrogation_Position=673; Antisense; TGGCTGATCCACTACCTTAAGTACA
>probe:Drosophila_2:1625510_at:344:669; Interrogation_Position=748; Antisense; TACGAGTCAGATCCCTCGGACTACT
>probe:Drosophila_2:1625510_at:210:639; Interrogation_Position=779; Antisense; TCGTGGGCAGCGGTAGCTACTCCAA
>probe:Drosophila_2:1625510_at:413:337; Interrogation_Position=835; Antisense; GCTCCTCACGAGTTGGGCGGCAATA
>probe:Drosophila_2:1625510_at:715:117; Interrogation_Position=859; Antisense; AGCTACAGCAAGGACTGGGCCACGA
>probe:Drosophila_2:1625510_at:498:137; Interrogation_Position=880; Antisense; ACGAGTAAGGCCTACAACGCGCACA
>probe:Drosophila_2:1625510_at:130:201; Interrogation_Position=895; Antisense; AACGCGCACAACTATCTTGACACGA

Paste this into a BLAST search page for me
CGCCGATGAGGTGGTCGTGTTCAACGACGATGATTCTCAAGTTCCTGAAAGAAACCACGGACTCCAACTGAGGCTGAAGAAGTGGCTCATTATCCTGCCCTGCCCCTCGTCATTCTGATGAAGATGATTGCCCACCTGAAGATGACTTTGTGCTCGGCATGAACGTGCTGCTGGTTGGCTGATCCACTACCTTAAGTACATACGAGTCAGATCCCTCGGACTACTTCGTGGGCAGCGGTAGCTACTCCAAGCTCCTCACGAGTTGGGCGGCAATAAGCTACAGCAAGGACTGGGCCACGAACGAGTAAGGCCTACAACGCGCACAAACGCGCACAACTATCTTGACACGA

Full Affymetrix probeset data:

Annotations for 1625510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720