FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625511_at:

>probe:Drosophila_2:1625511_at:728:383; Interrogation_Position=2432; Antisense; GAACAAAATAGTCATACCCGAGCGT
>probe:Drosophila_2:1625511_at:536:27; Interrogation_Position=2445; Antisense; ATACCCGAGCGTTACATACCTGAAA
>probe:Drosophila_2:1625511_at:420:27; Interrogation_Position=2460; Antisense; ATACCTGAAACAACGCCCGAGCTGT
>probe:Drosophila_2:1625511_at:281:423; Interrogation_Position=2511; Antisense; GAGAAGGTCGAGTCCATCAAGAAAA
>probe:Drosophila_2:1625511_at:74:185; Interrogation_Position=2532; Antisense; AAAATGCTGGCTGAGGCGCCCATTA
>probe:Drosophila_2:1625511_at:578:619; Interrogation_Position=2623; Antisense; TGCTGCAACTCAACCAAATCCTGGC
>probe:Drosophila_2:1625511_at:546:287; Interrogation_Position=2643; Antisense; CTGGCCCAACAGGTGATGCAAGTCA
>probe:Drosophila_2:1625511_at:207:219; Interrogation_Position=2662; Antisense; AAGTCAGCAAGATCGTGGCCGGAAA
>probe:Drosophila_2:1625511_at:562:285; Interrogation_Position=2681; Antisense; CGGAAATCCCACTAGTCACAACTAA
>probe:Drosophila_2:1625511_at:625:115; Interrogation_Position=2715; Antisense; AGCTTGTCGAGTTGTTTCTGTTCAC
>probe:Drosophila_2:1625511_at:521:715; Interrogation_Position=2730; Antisense; TTCTGTTCACCTTTTGTGTTTTACA
>probe:Drosophila_2:1625511_at:558:311; Interrogation_Position=2803; Antisense; GCCAATCTGAGAGGGTTCGCATAAC
>probe:Drosophila_2:1625511_at:440:429; Interrogation_Position=2842; Antisense; GAGTTTGCTGTTCGAAACATACCAA
>probe:Drosophila_2:1625511_at:76:89; Interrogation_Position=2885; Antisense; AGTACGATACACCTAACTATACAGT

Paste this into a BLAST search page for me
GAACAAAATAGTCATACCCGAGCGTATACCCGAGCGTTACATACCTGAAAATACCTGAAACAACGCCCGAGCTGTGAGAAGGTCGAGTCCATCAAGAAAAAAAATGCTGGCTGAGGCGCCCATTATGCTGCAACTCAACCAAATCCTGGCCTGGCCCAACAGGTGATGCAAGTCAAAGTCAGCAAGATCGTGGCCGGAAACGGAAATCCCACTAGTCACAACTAAAGCTTGTCGAGTTGTTTCTGTTCACTTCTGTTCACCTTTTGTGTTTTACAGCCAATCTGAGAGGGTTCGCATAACGAGTTTGCTGTTCGAAACATACCAAAGTACGATACACCTAACTATACAGT

Full Affymetrix probeset data:

Annotations for 1625511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720