Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625512_s_at:

>probe:Drosophila_2:1625512_s_at:404:155; Interrogation_Position=376; Antisense; ACAGACCACTGCATATCCACGGAAG
>probe:Drosophila_2:1625512_s_at:175:347; Interrogation_Position=450; Antisense; GATCGTTGGCCCTAGTAACCGATTG
>probe:Drosophila_2:1625512_s_at:415:523; Interrogation_Position=474; Antisense; GGGCTGTGCCATAGCCAGTATCGAA
>probe:Drosophila_2:1625512_s_at:158:635; Interrogation_Position=494; Antisense; TCGAAAAAGGCGGATGGACCCATCA
>probe:Drosophila_2:1625512_s_at:336:341; Interrogation_Position=522; Antisense; GCTAGCCTGTCTGTACAGCTGTTCA
>probe:Drosophila_2:1625512_s_at:547:599; Interrogation_Position=533; Antisense; TGTACAGCTGTTCACCCCAGAAGAA
>probe:Drosophila_2:1625512_s_at:319:297; Interrogation_Position=560; Antisense; CGCTTCTTTATGAGTATTCCGGAAA
>probe:Drosophila_2:1625512_s_at:239:175; Interrogation_Position=583; Antisense; AAACCGGGAGTATATTGCACCACTG
>probe:Drosophila_2:1625512_s_at:155:463; Interrogation_Position=658; Antisense; GATTGCATGCACTCTGAACTATTCC
>probe:Drosophila_2:1625512_s_at:305:7; Interrogation_Position=832; Antisense; ATTGCAGCTCGTATGCTCAAGTTGA
>probe:Drosophila_2:1625512_s_at:617:689; Interrogation_Position=879; Antisense; TTTGGCTACAATCTTGGTAAAGCGA
>probe:Drosophila_2:1625512_s_at:596:645; Interrogation_Position=890; Antisense; TCTTGGTAAAGCGATGCGATCTCCA
>probe:Drosophila_2:1625512_s_at:537:103; Interrogation_Position=921; Antisense; AGACCACTGCATATCCACGGAAGAG
>probe:Drosophila_2:1625512_s_at:21:563; Interrogation_Position=939; Antisense; GGAAGAGTTCTCGTCTCCAAGCTAC

Paste this into a BLAST search page for me
ACAGACCACTGCATATCCACGGAAGGATCGTTGGCCCTAGTAACCGATTGGGGCTGTGCCATAGCCAGTATCGAATCGAAAAAGGCGGATGGACCCATCAGCTAGCCTGTCTGTACAGCTGTTCATGTACAGCTGTTCACCCCAGAAGAACGCTTCTTTATGAGTATTCCGGAAAAAACCGGGAGTATATTGCACCACTGGATTGCATGCACTCTGAACTATTCCATTGCAGCTCGTATGCTCAAGTTGATTTGGCTACAATCTTGGTAAAGCGATCTTGGTAAAGCGATGCGATCTCCAAGACCACTGCATATCCACGGAAGAGGGAAGAGTTCTCGTCTCCAAGCTAC

Full Affymetrix probeset data:

Annotations for 1625512_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime