Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625516_at:

>probe:Drosophila_2:1625516_at:517:441; Interrogation_Position=4192; Antisense; GATGTGCCCTAAGATCCCCGATCAA
>probe:Drosophila_2:1625516_at:639:515; Interrogation_Position=4273; Antisense; GTGTCTATAAATACGTTACCACATA
>probe:Drosophila_2:1625516_at:420:637; Interrogation_Position=4307; Antisense; TCGAGTGTGCGAGTTACCAATGAAT
>probe:Drosophila_2:1625516_at:280:251; Interrogation_Position=4324; Antisense; CAATGAATGTCGGTAATGGCAAGAA
>probe:Drosophila_2:1625516_at:186:265; Interrogation_Position=4407; Antisense; CAGTAACTCAAATATTCGATGCATA
>probe:Drosophila_2:1625516_at:336:363; Interrogation_Position=4508; Antisense; GAATTTTACTATTATGTGGGTTACG
>probe:Drosophila_2:1625516_at:147:633; Interrogation_Position=4635; Antisense; TAATCGGGTTTAAGCTTAGTGGCGC
>probe:Drosophila_2:1625516_at:283:705; Interrogation_Position=4650; Antisense; TTAGTGGCGCTCCTCTCGCATTTTT
>probe:Drosophila_2:1625516_at:605:377; Interrogation_Position=4678; Antisense; GAAGCAGCAATTTAACCGGTTCAGT
>probe:Drosophila_2:1625516_at:275:541; Interrogation_Position=4695; Antisense; GGTTCAGTTGTTGTAGATGGCGCCA
>probe:Drosophila_2:1625516_at:125:441; Interrogation_Position=4710; Antisense; GATGGCGCCAAGTCTAGTTGCTAGT
>probe:Drosophila_2:1625516_at:685:277; Interrogation_Position=4723; Antisense; CTAGTTGCTAGTGCCCGTGTAGGTG
>probe:Drosophila_2:1625516_at:593:575; Interrogation_Position=4747; Antisense; GGCGCTTGCCGGTGATGCCTGCATA
>probe:Drosophila_2:1625516_at:621:447; Interrogation_Position=4760; Antisense; GATGCCTGCATAGGTGGCGCCACTA

Paste this into a BLAST search page for me
GATGTGCCCTAAGATCCCCGATCAAGTGTCTATAAATACGTTACCACATATCGAGTGTGCGAGTTACCAATGAATCAATGAATGTCGGTAATGGCAAGAACAGTAACTCAAATATTCGATGCATAGAATTTTACTATTATGTGGGTTACGTAATCGGGTTTAAGCTTAGTGGCGCTTAGTGGCGCTCCTCTCGCATTTTTGAAGCAGCAATTTAACCGGTTCAGTGGTTCAGTTGTTGTAGATGGCGCCAGATGGCGCCAAGTCTAGTTGCTAGTCTAGTTGCTAGTGCCCGTGTAGGTGGGCGCTTGCCGGTGATGCCTGCATAGATGCCTGCATAGGTGGCGCCACTA

Full Affymetrix probeset data:

Annotations for 1625516_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime