FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625517_at:

>probe:Drosophila_2:1625517_at:714:413; Interrogation_Position=424; Antisense; GACCACCGAATGCATACAGACGATG
>probe:Drosophila_2:1625517_at:719:453; Interrogation_Position=548; Antisense; GATCAGTTCAGCGAATTTCTCAGCG
>probe:Drosophila_2:1625517_at:267:75; Interrogation_Position=591; Antisense; AGGAGGCCGACGACGAAGACCTCGA
>probe:Drosophila_2:1625517_at:684:211; Interrogation_Position=606; Antisense; AAGACCTCGACCAGGACTTCAGTAG
>probe:Drosophila_2:1625517_at:109:445; Interrogation_Position=643; Antisense; GATGAAGACCTTCCACGCATAGCCG
>probe:Drosophila_2:1625517_at:183:27; Interrogation_Position=661; Antisense; ATAGCCGCTGATCCAATCCAAAGTG
>probe:Drosophila_2:1625517_at:172:171; Interrogation_Position=680; Antisense; AAAGTGCTGCTTACAGGCGTGTTCC
>probe:Drosophila_2:1625517_at:261:273; Interrogation_Position=707; Antisense; CTTCCGTTTTCACCGACATTCTGAA
>probe:Drosophila_2:1625517_at:548:401; Interrogation_Position=721; Antisense; GACATTCTGAATTCTTACGTGGATT
>probe:Drosophila_2:1625517_at:426:359; Interrogation_Position=776; Antisense; GCAATAGCCCTCGAAAAGTTGTGAA
>probe:Drosophila_2:1625517_at:571:31; Interrogation_Position=877; Antisense; ATAATCATCATTAGCTGTAAGCCCA
>probe:Drosophila_2:1625517_at:488:259; Interrogation_Position=912; Antisense; CACCCAATCGACCTTAATTTGTATG
>probe:Drosophila_2:1625517_at:169:21; Interrogation_Position=928; Antisense; ATTTGTATGCGTGCGTCTTTTCTAC
>probe:Drosophila_2:1625517_at:276:187; Interrogation_Position=957; Antisense; AACAAATTGTCACTCTGTGCGCAAA

Paste this into a BLAST search page for me
GACCACCGAATGCATACAGACGATGGATCAGTTCAGCGAATTTCTCAGCGAGGAGGCCGACGACGAAGACCTCGAAAGACCTCGACCAGGACTTCAGTAGGATGAAGACCTTCCACGCATAGCCGATAGCCGCTGATCCAATCCAAAGTGAAAGTGCTGCTTACAGGCGTGTTCCCTTCCGTTTTCACCGACATTCTGAAGACATTCTGAATTCTTACGTGGATTGCAATAGCCCTCGAAAAGTTGTGAAATAATCATCATTAGCTGTAAGCCCACACCCAATCGACCTTAATTTGTATGATTTGTATGCGTGCGTCTTTTCTACAACAAATTGTCACTCTGTGCGCAAA

Full Affymetrix probeset data:

Annotations for 1625517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720