Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625519_at:

>probe:Drosophila_2:1625519_at:153:547; Interrogation_Position=1664; Antisense; TTAGTTGTGCCCTGGAACCCAAAAT
>probe:Drosophila_2:1625519_at:698:583; Interrogation_Position=1676; Antisense; TGGAACCCAAAATCACTGCCGTCAG
>probe:Drosophila_2:1625519_at:657:123; Interrogation_Position=1703; Antisense; AGCCCAATCGCTGTGAATACTACTT
>probe:Drosophila_2:1625519_at:490:667; Interrogation_Position=1723; Antisense; TACTTTGAATTCGAAACTCCCGCCG
>probe:Drosophila_2:1625519_at:285:317; Interrogation_Position=1747; Antisense; GCCTGCGACAGCGAAGCTTTCCAGT
>probe:Drosophila_2:1625519_at:719:377; Interrogation_Position=1759; Antisense; GAAGCTTTCCAGTCCGAATCGGAGA
>probe:Drosophila_2:1625519_at:633:421; Interrogation_Position=1780; Antisense; GAGAATCTGCACGACGAACTCTGAA
>probe:Drosophila_2:1625519_at:102:395; Interrogation_Position=1802; Antisense; GAAATGTTCAACAATCGACGATGAG
>probe:Drosophila_2:1625519_at:168:367; Interrogation_Position=1847; Antisense; GAATGCTTGGCATGCGTAGACCAGA
>probe:Drosophila_2:1625519_at:311:599; Interrogation_Position=1915; Antisense; TGTCGAGATCATTCCCAAACTGCAG
>probe:Drosophila_2:1625519_at:221:709; Interrogation_Position=2078; Antisense; TTAAAGTCGGTTTCCTTGAGCTCAA
>probe:Drosophila_2:1625519_at:86:17; Interrogation_Position=2113; Antisense; ATTTTACTTTCGTGATACTTGAGCA
>probe:Drosophila_2:1625519_at:317:421; Interrogation_Position=2133; Antisense; GAGCACAGACGATTTCAAGGTATAG
>probe:Drosophila_2:1625519_at:293:231; Interrogation_Position=2204; Antisense; AATGTACACATTTTAGGCAGCAAGA

Paste this into a BLAST search page for me
TTAGTTGTGCCCTGGAACCCAAAATTGGAACCCAAAATCACTGCCGTCAGAGCCCAATCGCTGTGAATACTACTTTACTTTGAATTCGAAACTCCCGCCGGCCTGCGACAGCGAAGCTTTCCAGTGAAGCTTTCCAGTCCGAATCGGAGAGAGAATCTGCACGACGAACTCTGAAGAAATGTTCAACAATCGACGATGAGGAATGCTTGGCATGCGTAGACCAGATGTCGAGATCATTCCCAAACTGCAGTTAAAGTCGGTTTCCTTGAGCTCAAATTTTACTTTCGTGATACTTGAGCAGAGCACAGACGATTTCAAGGTATAGAATGTACACATTTTAGGCAGCAAGA

Full Affymetrix probeset data:

Annotations for 1625519_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime