FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625521_at:

>probe:Drosophila_2:1625521_at:66:135; Interrogation_Position=166; Antisense; ACGCCCTTGACTTGTGTGCAACAAT
>probe:Drosophila_2:1625521_at:476:341; Interrogation_Position=196; Antisense; GCTTTACTAGGCTCAACATCAGGAA
>probe:Drosophila_2:1625521_at:344:377; Interrogation_Position=227; Antisense; GAAGCTGCTCCGTATTTTTTACACT
>probe:Drosophila_2:1625521_at:247:257; Interrogation_Position=248; Antisense; CACTATTTGGCGTATACTGCGGCGT
>probe:Drosophila_2:1625521_at:185:573; Interrogation_Position=268; Antisense; GGCGTTCTCATCTTTCGGGCGTATC
>probe:Drosophila_2:1625521_at:248:573; Interrogation_Position=285; Antisense; GGCGTATCGCACATATTCCTCTAAG
>probe:Drosophila_2:1625521_at:368:413; Interrogation_Position=380; Antisense; GACCTGGTTCCAGTCTTGTGAACGA
>probe:Drosophila_2:1625521_at:231:199; Interrogation_Position=417; Antisense; AACGAAGCCGATTCTGTTGCAACCC
>probe:Drosophila_2:1625521_at:477:301; Interrogation_Position=440; Antisense; CCGTCGGTTTTTCCAGTACTGACAT
>probe:Drosophila_2:1625521_at:256:427; Interrogation_Position=465; Antisense; GAGATGGCGCTATTGCAACCACTTG
>probe:Drosophila_2:1625521_at:367:107; Interrogation_Position=599; Antisense; AGAAGCCGGTTGCATCCACATCGAT
>probe:Drosophila_2:1625521_at:71:153; Interrogation_Position=616; Antisense; ACATCGATGGCAACGGCTCGGGCGC
>probe:Drosophila_2:1625521_at:630:441; Interrogation_Position=655; Antisense; GATGGTGAACACGTCGAGCCCACAC
>probe:Drosophila_2:1625521_at:137:417; Interrogation_Position=670; Antisense; GAGCCCACACCATTTTCGGTGTGAA

Paste this into a BLAST search page for me
ACGCCCTTGACTTGTGTGCAACAATGCTTTACTAGGCTCAACATCAGGAAGAAGCTGCTCCGTATTTTTTACACTCACTATTTGGCGTATACTGCGGCGTGGCGTTCTCATCTTTCGGGCGTATCGGCGTATCGCACATATTCCTCTAAGGACCTGGTTCCAGTCTTGTGAACGAAACGAAGCCGATTCTGTTGCAACCCCCGTCGGTTTTTCCAGTACTGACATGAGATGGCGCTATTGCAACCACTTGAGAAGCCGGTTGCATCCACATCGATACATCGATGGCAACGGCTCGGGCGCGATGGTGAACACGTCGAGCCCACACGAGCCCACACCATTTTCGGTGTGAA

Full Affymetrix probeset data:

Annotations for 1625521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720