FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625523_at:

>probe:Drosophila_2:1625523_at:534:451; Interrogation_Position=1061; Antisense; GATCAAAGACCACGCTGTTTACCAT
>probe:Drosophila_2:1625523_at:14:671; Interrogation_Position=520; Antisense; TACTGGATGCTGGACTCATCGGCAT
>probe:Drosophila_2:1625523_at:320:271; Interrogation_Position=536; Antisense; CATCGGCATCGGACATGTTCGAACA
>probe:Drosophila_2:1625523_at:259:523; Interrogation_Position=602; Antisense; GTGGCCATCCAAATCGCTACGAGAG
>probe:Drosophila_2:1625523_at:455:485; Interrogation_Position=659; Antisense; GTAGTGCAGCAGAGATTCGCTCGCC
>probe:Drosophila_2:1625523_at:471:433; Interrogation_Position=696; Antisense; GAGTGACTTCGATATCTTCTGCAAC
>probe:Drosophila_2:1625523_at:338:577; Interrogation_Position=725; Antisense; GGCCCAATTACTCCGACAGGATTAC
>probe:Drosophila_2:1625523_at:695:151; Interrogation_Position=740; Antisense; ACAGGATTACGGATCTGCACAGGCA
>probe:Drosophila_2:1625523_at:671:615; Interrogation_Position=755; Antisense; TGCACAGGCAGTACTTGTCCGTATC
>probe:Drosophila_2:1625523_at:18:485; Interrogation_Position=775; Antisense; GTATCCCTGGGCTTCAACAGTCTGT
>probe:Drosophila_2:1625523_at:207:89; Interrogation_Position=793; Antisense; AGTCTGTTCAACAACGAGGCCCGCG
>probe:Drosophila_2:1625523_at:354:281; Interrogation_Position=867; Antisense; CTCGTCCAGTTCCAGCAAAGCAATG
>probe:Drosophila_2:1625523_at:273:617; Interrogation_Position=908; Antisense; TGCACGAGGAGCTACATTCGCCGAG
>probe:Drosophila_2:1625523_at:670:283; Interrogation_Position=983; Antisense; CTGTCCTTGCCGAAGCTTTTAATGG

Paste this into a BLAST search page for me
GATCAAAGACCACGCTGTTTACCATTACTGGATGCTGGACTCATCGGCATCATCGGCATCGGACATGTTCGAACAGTGGCCATCCAAATCGCTACGAGAGGTAGTGCAGCAGAGATTCGCTCGCCGAGTGACTTCGATATCTTCTGCAACGGCCCAATTACTCCGACAGGATTACACAGGATTACGGATCTGCACAGGCATGCACAGGCAGTACTTGTCCGTATCGTATCCCTGGGCTTCAACAGTCTGTAGTCTGTTCAACAACGAGGCCCGCGCTCGTCCAGTTCCAGCAAAGCAATGTGCACGAGGAGCTACATTCGCCGAGCTGTCCTTGCCGAAGCTTTTAATGG

Full Affymetrix probeset data:

Annotations for 1625523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720