Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625524_at:

>probe:Drosophila_2:1625524_at:352:113; Interrogation_Position=1021; Antisense; AGCACTTAGTGCTCACCAGGCAGAG
>probe:Drosophila_2:1625524_at:12:101; Interrogation_Position=1042; Antisense; AGAGGCTGATGTAGTCATGACCACA
>probe:Drosophila_2:1625524_at:1:117; Interrogation_Position=1077; Antisense; AGCATTACGGCATTGATTTCCTGGC
>probe:Drosophila_2:1625524_at:93:295; Interrogation_Position=1108; Antisense; CGAGGAGCAGGCCATTCCATTCCAG
>probe:Drosophila_2:1625524_at:530:9; Interrogation_Position=1121; Antisense; ATTCCATTCCAGCAAGTGGTGCCAC
>probe:Drosophila_2:1625524_at:251:727; Interrogation_Position=1146; Antisense; TTGGCTCTCCTGTTTGTCGAAAAAA
>probe:Drosophila_2:1625524_at:559:223; Interrogation_Position=740; Antisense; AAGGAGCCAGAAGCGGTCGTGAACA
>probe:Drosophila_2:1625524_at:56:499; Interrogation_Position=755; Antisense; GTCGTGAACATCGATTGGCGAACCA
>probe:Drosophila_2:1625524_at:44:393; Interrogation_Position=785; Antisense; GAAACCACTCCAAATCGTCCAATTT
>probe:Drosophila_2:1625524_at:378:439; Interrogation_Position=821; Antisense; GAGGCATTCGCCAAGCGTAAGTTAT
>probe:Drosophila_2:1625524_at:598:625; Interrogation_Position=886; Antisense; TCCCAAGCGGAAACCCGATGAGTTT
>probe:Drosophila_2:1625524_at:78:57; Interrogation_Position=903; Antisense; ATGAGTTTAGGTCACGACGCCAGCT
>probe:Drosophila_2:1625524_at:385:411; Interrogation_Position=918; Antisense; GACGCCAGCTGTTCAGTGGATGCAA
>probe:Drosophila_2:1625524_at:128:517; Interrogation_Position=943; Antisense; GTGTGCCGAGAACAAACGCTATCCC

Paste this into a BLAST search page for me
AGCACTTAGTGCTCACCAGGCAGAGAGAGGCTGATGTAGTCATGACCACAAGCATTACGGCATTGATTTCCTGGCCGAGGAGCAGGCCATTCCATTCCAGATTCCATTCCAGCAAGTGGTGCCACTTGGCTCTCCTGTTTGTCGAAAAAAAAGGAGCCAGAAGCGGTCGTGAACAGTCGTGAACATCGATTGGCGAACCAGAAACCACTCCAAATCGTCCAATTTGAGGCATTCGCCAAGCGTAAGTTATTCCCAAGCGGAAACCCGATGAGTTTATGAGTTTAGGTCACGACGCCAGCTGACGCCAGCTGTTCAGTGGATGCAAGTGTGCCGAGAACAAACGCTATCCC

Full Affymetrix probeset data:

Annotations for 1625524_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime