FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625526_at:

>probe:Drosophila_2:1625526_at:344:561; Interrogation_Position=422; Antisense; GGAATGGCACTCCTGGGTCTTCTTT
>probe:Drosophila_2:1625526_at:654:371; Interrogation_Position=494; Antisense; GAAGGAGCTCATCGATGCGACCAAA
>probe:Drosophila_2:1625526_at:78:671; Interrogation_Position=540; Antisense; TACGATGCACTGTTCGTCCACGAGA
>probe:Drosophila_2:1625526_at:509:137; Interrogation_Position=559; Antisense; ACGAGATCGCCTTTCCGGATGAGCT
>probe:Drosophila_2:1625526_at:138:537; Interrogation_Position=575; Antisense; GGATGAGCTCTACTTTAACCGGGAT
>probe:Drosophila_2:1625526_at:143:709; Interrogation_Position=589; Antisense; TTAACCGGGATTTCCTGTCGACCAT
>probe:Drosophila_2:1625526_at:478:61; Interrogation_Position=619; Antisense; ATGTCTTTGGCTTTGTGGCCCAGCA
>probe:Drosophila_2:1625526_at:439:319; Interrogation_Position=696; Antisense; GCCGCCAGTCTGATCGATTACGAAG
>probe:Drosophila_2:1625526_at:485:331; Interrogation_Position=728; Antisense; GCGGACTATCTACTCGATCTACAAG
>probe:Drosophila_2:1625526_at:665:687; Interrogation_Position=771; Antisense; TTTGACATCCTTCGCGAGCTAGACG
>probe:Drosophila_2:1625526_at:127:489; Interrogation_Position=800; Antisense; GTACGCACTGCTGTTTGAACTGGCC
>probe:Drosophila_2:1625526_at:31:389; Interrogation_Position=912; Antisense; GAAAAGCGCCACGACGACGATATTT
>probe:Drosophila_2:1625526_at:655:695; Interrogation_Position=943; Antisense; TTTCCTGCTGTCTTCTTCACATAAA
>probe:Drosophila_2:1625526_at:662:663; Interrogation_Position=964; Antisense; TAAATGTCTGCCTACTCTTGGGCTA

Paste this into a BLAST search page for me
GGAATGGCACTCCTGGGTCTTCTTTGAAGGAGCTCATCGATGCGACCAAATACGATGCACTGTTCGTCCACGAGAACGAGATCGCCTTTCCGGATGAGCTGGATGAGCTCTACTTTAACCGGGATTTAACCGGGATTTCCTGTCGACCATATGTCTTTGGCTTTGTGGCCCAGCAGCCGCCAGTCTGATCGATTACGAAGGCGGACTATCTACTCGATCTACAAGTTTGACATCCTTCGCGAGCTAGACGGTACGCACTGCTGTTTGAACTGGCCGAAAAGCGCCACGACGACGATATTTTTTCCTGCTGTCTTCTTCACATAAATAAATGTCTGCCTACTCTTGGGCTA

Full Affymetrix probeset data:

Annotations for 1625526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720