FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625527_at:

>probe:Drosophila_2:1625527_at:231:335; Interrogation_Position=1448; Antisense; GCTCCAATGAATCCCTGGCTTTTTG
>probe:Drosophila_2:1625527_at:513:571; Interrogation_Position=1464; Antisense; GGCTTTTTGCCACGCCATGGATGAT
>probe:Drosophila_2:1625527_at:267:445; Interrogation_Position=1585; Antisense; GATCGTCACCTCTTTGGACTTAAAC
>probe:Drosophila_2:1625527_at:149:223; Interrogation_Position=1611; Antisense; AATGGCGGTGGAGAACTGCCTACCT
>probe:Drosophila_2:1625527_at:577:93; Interrogation_Position=1643; Antisense; AGTTCTTCTCTTCGCCAGGATATGT
>probe:Drosophila_2:1625527_at:601:489; Interrogation_Position=1666; Antisense; GTAAAGTCCACGCACTTTCGAATGT
>probe:Drosophila_2:1625527_at:69:697; Interrogation_Position=1681; Antisense; TTTCGAATGTCCACTTCGCAGGTGG
>probe:Drosophila_2:1625527_at:409:579; Interrogation_Position=1704; Antisense; GGCCACCAAATATGATGCCTTCATG
>probe:Drosophila_2:1625527_at:228:627; Interrogation_Position=1719; Antisense; TGCCTTCATGGGATATGGACCTTCT
>probe:Drosophila_2:1625527_at:147:441; Interrogation_Position=1750; Antisense; GATGGATATGCCTGTTGCTACAATC
>probe:Drosophila_2:1625527_at:682:159; Interrogation_Position=1769; Antisense; ACAATCCCCGTGAACATGACATCAT
>probe:Drosophila_2:1625527_at:466:45; Interrogation_Position=1803; Antisense; ATCCGCATGGCGACATTGTCAGGCA
>probe:Drosophila_2:1625527_at:26:345; Interrogation_Position=1854; Antisense; GCTTGCGCAGTCCTTTGCTGAAATG
>probe:Drosophila_2:1625527_at:192:321; Interrogation_Position=1917; Antisense; GCCGCCAGAGCTTAAGTGCAAGTAT

Paste this into a BLAST search page for me
GCTCCAATGAATCCCTGGCTTTTTGGGCTTTTTGCCACGCCATGGATGATGATCGTCACCTCTTTGGACTTAAACAATGGCGGTGGAGAACTGCCTACCTAGTTCTTCTCTTCGCCAGGATATGTGTAAAGTCCACGCACTTTCGAATGTTTTCGAATGTCCACTTCGCAGGTGGGGCCACCAAATATGATGCCTTCATGTGCCTTCATGGGATATGGACCTTCTGATGGATATGCCTGTTGCTACAATCACAATCCCCGTGAACATGACATCATATCCGCATGGCGACATTGTCAGGCAGCTTGCGCAGTCCTTTGCTGAAATGGCCGCCAGAGCTTAAGTGCAAGTAT

Full Affymetrix probeset data:

Annotations for 1625527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720