Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625528_at:

>probe:Drosophila_2:1625528_at:434:23; Interrogation_Position=1245; Antisense; ATATCGATTACCTGCACATCTCGGA
>probe:Drosophila_2:1625528_at:289:649; Interrogation_Position=1275; Antisense; TCAGTGGGCCCATCCAGCAGGAAGA
>probe:Drosophila_2:1625528_at:183:391; Interrogation_Position=1322; Antisense; GAAACCAAGGCCGTGCTTCTCGCAG
>probe:Drosophila_2:1625528_at:590:713; Interrogation_Position=1338; Antisense; TTCTCGCAGGCTTCAATTTGCCGAA
>probe:Drosophila_2:1625528_at:471:693; Interrogation_Position=1354; Antisense; TTTGCCGAAGCACGCCGAAATGGAG
>probe:Drosophila_2:1625528_at:172:173; Interrogation_Position=1426; Antisense; AAAGACCTATCGCATGTCCAAGGAG
>probe:Drosophila_2:1625528_at:474:157; Interrogation_Position=1467; Antisense; ACAAAAACCGTCAGCGCGTGGAGGA
>probe:Drosophila_2:1625528_at:476:93; Interrogation_Position=1494; Antisense; AGTTCTTGAAGAGCACCCATGCCGC
>probe:Drosophila_2:1625528_at:475:335; Interrogation_Position=1529; Antisense; GCTGCCGCTCAGAGACGTGAGGATA
>probe:Drosophila_2:1625528_at:639:437; Interrogation_Position=1589; Antisense; GAGGACCCAGAGAAGCAGCGCCGTT
>probe:Drosophila_2:1625528_at:410:709; Interrogation_Position=1697; Antisense; TTCAATTGTGCCATTTGCCGCAAGG
>probe:Drosophila_2:1625528_at:220:223; Interrogation_Position=1718; Antisense; AAGGAGCGCACCTCATTAACGTACA
>probe:Drosophila_2:1625528_at:276:483; Interrogation_Position=1757; Antisense; GTAGATGTTCCTCTCAAATGCCAGA
>probe:Drosophila_2:1625528_at:43:279; Interrogation_Position=1794; Antisense; CTATTTGTTTCCTATGGAGCGCCAA

Paste this into a BLAST search page for me
ATATCGATTACCTGCACATCTCGGATCAGTGGGCCCATCCAGCAGGAAGAGAAACCAAGGCCGTGCTTCTCGCAGTTCTCGCAGGCTTCAATTTGCCGAATTTGCCGAAGCACGCCGAAATGGAGAAAGACCTATCGCATGTCCAAGGAGACAAAAACCGTCAGCGCGTGGAGGAAGTTCTTGAAGAGCACCCATGCCGCGCTGCCGCTCAGAGACGTGAGGATAGAGGACCCAGAGAAGCAGCGCCGTTTTCAATTGTGCCATTTGCCGCAAGGAAGGAGCGCACCTCATTAACGTACAGTAGATGTTCCTCTCAAATGCCAGACTATTTGTTTCCTATGGAGCGCCAA

Full Affymetrix probeset data:

Annotations for 1625528_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime