FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625529_at:

>probe:Drosophila_2:1625529_at:265:65; Interrogation_Position=118; Antisense; ATGGGCAAGTGTGTCTCCCGGCAGT
>probe:Drosophila_2:1625529_at:192:45; Interrogation_Position=202; Antisense; ATCGCACTGTCCCACGAAGATTTGG
>probe:Drosophila_2:1625529_at:86:375; Interrogation_Position=217; Antisense; GAAGATTTGGCCCAGGCACTCAAAA
>probe:Drosophila_2:1625529_at:383:73; Interrogation_Position=230; Antisense; AGGCACTCAAAATCTGGCAACAGTT
>probe:Drosophila_2:1625529_at:11:55; Interrogation_Position=266; Antisense; ATGAATACATTGCAGCCGGGCCATC
>probe:Drosophila_2:1625529_at:105:419; Interrogation_Position=376; Antisense; GAGCAGGCCGTGTTGCATATCGAGT
>probe:Drosophila_2:1625529_at:208:591; Interrogation_Position=395; Antisense; TCGAGTCCCTTTACAATGATGCCGC
>probe:Drosophila_2:1625529_at:117:563; Interrogation_Position=432; Antisense; GGAACCAGTGACATCAGCCAGCGAA
>probe:Drosophila_2:1625529_at:677:549; Interrogation_Position=459; Antisense; GGAGTACTCCACTTGCCAGGAATTC
>probe:Drosophila_2:1625529_at:460:73; Interrogation_Position=476; Antisense; AGGAATTCCTGCTGCACGAACTGCT
>probe:Drosophila_2:1625529_at:552:349; Interrogation_Position=501; Antisense; GCAGGTCATCGAGGAACATGCAGCC
>probe:Drosophila_2:1625529_at:79:415; Interrogation_Position=540; Antisense; GACCAACCACATCCTGAATCAGTCT
>probe:Drosophila_2:1625529_at:685:365; Interrogation_Position=555; Antisense; GAATCAGTCTCGAATCAGGCCAGAA
>probe:Drosophila_2:1625529_at:612:379; Interrogation_Position=577; Antisense; GAACCTCAATTACCCGTCGAGAACA

Paste this into a BLAST search page for me
ATGGGCAAGTGTGTCTCCCGGCAGTATCGCACTGTCCCACGAAGATTTGGGAAGATTTGGCCCAGGCACTCAAAAAGGCACTCAAAATCTGGCAACAGTTATGAATACATTGCAGCCGGGCCATCGAGCAGGCCGTGTTGCATATCGAGTTCGAGTCCCTTTACAATGATGCCGCGGAACCAGTGACATCAGCCAGCGAAGGAGTACTCCACTTGCCAGGAATTCAGGAATTCCTGCTGCACGAACTGCTGCAGGTCATCGAGGAACATGCAGCCGACCAACCACATCCTGAATCAGTCTGAATCAGTCTCGAATCAGGCCAGAAGAACCTCAATTACCCGTCGAGAACA

Full Affymetrix probeset data:

Annotations for 1625529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720