Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625530_at:

>probe:Drosophila_2:1625530_at:145:421; Interrogation_Position=2447; Antisense; GAGCACAACGGCTACTTACGCAGTG
>probe:Drosophila_2:1625530_at:52:673; Interrogation_Position=2463; Antisense; TACGCAGTGAGGACCCGCTCAACAT
>probe:Drosophila_2:1625530_at:294:337; Interrogation_Position=2479; Antisense; GCTCAACATTTTGTCCCAACGTGAT
>probe:Drosophila_2:1625530_at:628:493; Interrogation_Position=2604; Antisense; GTCTGGAGAGGTATTCCCACGGAAT
>probe:Drosophila_2:1625530_at:243:393; Interrogation_Position=2636; Antisense; GAAAGGGTCTGGCTACTCATTGTAT
>probe:Drosophila_2:1625530_at:120:613; Interrogation_Position=2818; Antisense; TGACAAAGTATTTGGCGGCACCACA
>probe:Drosophila_2:1625530_at:696:153; Interrogation_Position=2840; Antisense; ACAGGGCTCACAGACTCATCATAGT
>probe:Drosophila_2:1625530_at:116:405; Interrogation_Position=2852; Antisense; GACTCATCATAGTTGGCTCGTAAAA
>probe:Drosophila_2:1625530_at:361:639; Interrogation_Position=2877; Antisense; TCTTACTTGGAAAGCACTACCCCAC
>probe:Drosophila_2:1625530_at:526:309; Interrogation_Position=2898; Antisense; CCACCAGCCGATTGACCAGAGATTG
>probe:Drosophila_2:1625530_at:111:99; Interrogation_Position=2915; Antisense; AGAGATTGCTCCCTCTGATTACAAT
>probe:Drosophila_2:1625530_at:685:161; Interrogation_Position=2935; Antisense; ACAATTTTTCCTCATGATGGCTCAT
>probe:Drosophila_2:1625530_at:118:69; Interrogation_Position=2951; Antisense; ATGGCTCATGGCTTGGCAGGCTTCT
>probe:Drosophila_2:1625530_at:337:349; Interrogation_Position=2966; Antisense; GCAGGCTTCTTCGTCTATGATGTAT

Paste this into a BLAST search page for me
GAGCACAACGGCTACTTACGCAGTGTACGCAGTGAGGACCCGCTCAACATGCTCAACATTTTGTCCCAACGTGATGTCTGGAGAGGTATTCCCACGGAATGAAAGGGTCTGGCTACTCATTGTATTGACAAAGTATTTGGCGGCACCACAACAGGGCTCACAGACTCATCATAGTGACTCATCATAGTTGGCTCGTAAAATCTTACTTGGAAAGCACTACCCCACCCACCAGCCGATTGACCAGAGATTGAGAGATTGCTCCCTCTGATTACAATACAATTTTTCCTCATGATGGCTCATATGGCTCATGGCTTGGCAGGCTTCTGCAGGCTTCTTCGTCTATGATGTAT

Full Affymetrix probeset data:

Annotations for 1625530_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime